diff --git a/.github/workflows/pydna_test_and_coverage_workflow.yml b/.github/workflows/pydna_test_and_coverage_workflow.yml index 2e2e4554..35ea2e5f 100644 --- a/.github/workflows/pydna_test_and_coverage_workflow.yml +++ b/.github/workflows/pydna_test_and_coverage_workflow.yml @@ -15,17 +15,17 @@ jobs: fail-fast: false matrix: os: ["macos-latest", "windows-latest"] - python-version: ["3.12", "3.11", "3.10", "3.9"] + python-version: ["3.13", "3.12", "3.11", "3.10"] include: - - os: ubuntu-latest - python-version: "3.9" - codecov: true - os: ubuntu-latest python-version: "3.10" + codecov: true - os: ubuntu-latest python-version: "3.11" - os: ubuntu-latest python-version: "3.12" + - os: ubuntu-latest + python-version: "3.13" defaults: run: shell: bash diff --git a/poetry.lock b/poetry.lock index 178d32cd..70584d25 100644 --- a/poetry.lock +++ b/poetry.lock @@ -1,4 +1,4 @@ -# This file is automatically @generated by Poetry 1.8.2 and should not be changed by hand. +# This file is automatically @generated by Poetry 2.0.1 and should not be changed by hand. [[package]] name = "alabaster" @@ -6,6 +6,7 @@ version = "0.7.16" description = "A light, configurable Sphinx theme" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "alabaster-0.7.16-py3-none-any.whl", hash = "sha256:b46733c07dce03ae4e150330b975c75737fa60f0a7c591b6c8bf4928a28e2c92"}, {file = "alabaster-0.7.16.tar.gz", hash = "sha256:75a8b99c28a5dad50dd7f8ccdd447a121ddb3892da9e53d1ca5cca3106d58d65"}, @@ -17,6 +18,7 @@ version = "1.4.4" description = "A small Python module for determining appropriate platform-specific dirs, e.g. a \"user data dir\"." optional = false python-versions = "*" +groups = ["main"] files = [ {file = "appdirs-1.4.4-py2.py3-none-any.whl", hash = "sha256:a841dacd6b99318a741b166adb07e19ee71a274450e68237b4650ca1055ab128"}, {file = "appdirs-1.4.4.tar.gz", hash = "sha256:7d5d0167b2b1ba821647616af46a749d1c653740dd0d2415100fe26e27afdf41"}, @@ -28,6 +30,8 @@ version = "0.1.4" description = "Disable App Nap on macOS >= 10.9" optional = false python-versions = ">=3.6" +groups = ["test"] +markers = "platform_system == \"Darwin\"" files = [ {file = "appnope-0.1.4-py2.py3-none-any.whl", hash = "sha256:502575ee11cd7a28c0205f379b525beefebab9d161b7c964670864014ed7213c"}, {file = "appnope-0.1.4.tar.gz", hash = "sha256:1de3860566df9caf38f01f86f65e0e13e379af54f9e4bee1e66b48f2efffd1ee"}, @@ -39,6 +43,7 @@ version = "3.0.0" description = "Annotate AST trees with source code positions" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "asttokens-3.0.0-py3-none-any.whl", hash = "sha256:e3078351a059199dd5138cb1c706e6430c05eff2ff136af5eb4790f9d28932e2"}, {file = "asttokens-3.0.0.tar.gz", hash = "sha256:0dcd8baa8d62b0c1d118b399b2ddba3c4aff271d0d7a9e0d4c1681c79035bbc7"}, @@ -54,6 +59,7 @@ version = "24.3.0" description = "Classes Without Boilerplate" optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "attrs-24.3.0-py3-none-any.whl", hash = "sha256:ac96cd038792094f438ad1f6ff80837353805ac950cd2aa0e0625ef19850c308"}, {file = "attrs-24.3.0.tar.gz", hash = "sha256:8f5c07333d543103541ba7be0e2ce16eeee8130cb0b3f9238ab904ce1e85baff"}, @@ -73,6 +79,7 @@ version = "2.3.2" description = "A tool that automatically formats Python code to conform to the PEP 8 style guide" optional = false python-versions = ">=3.9" +groups = ["dev"] files = [ {file = "autopep8-2.3.2-py2.py3-none-any.whl", hash = "sha256:ce8ad498672c845a0c3de2629c15b635ec2b05ef8177a6e7c91c74f3e9b51128"}, {file = "autopep8-2.3.2.tar.gz", hash = "sha256:89440a4f969197b69a995e4ce0661b031f455a9f776d2c5ba3dbd83466931758"}, @@ -88,6 +95,7 @@ version = "2.16.0" description = "Internationalization utilities" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "babel-2.16.0-py3-none-any.whl", hash = "sha256:368b5b98b37c06b7daf6696391c3240c938b37767d4584413e8438c5c435fa8b"}, {file = "babel-2.16.0.tar.gz", hash = "sha256:d1f3554ca26605fe173f3de0c65f750f5a42f924499bf134de6423582298e316"}, @@ -102,6 +110,7 @@ version = "4.12.3" description = "Screen-scraping library" optional = false python-versions = ">=3.6.0" +groups = ["docs"] files = [ {file = "beautifulsoup4-4.12.3-py3-none-any.whl", hash = "sha256:b80878c9f40111313e55da8ba20bdba06d8fa3969fc68304167741bbf9e082ed"}, {file = "beautifulsoup4-4.12.3.tar.gz", hash = "sha256:74e3d1928edc070d21748185c46e3fb33490f22f52a3addee9aee0f4f7781051"}, @@ -123,6 +132,7 @@ version = "1.85" description = "Freely available tools for computational molecular biology." optional = false python-versions = ">=3.9" +groups = ["main"] files = [ {file = "biopython-1.85-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:a6308053a61f3bdbb11504ece4cf24e264c6f1d6fad278f7e59e6b84b0d9a7b4"}, {file = "biopython-1.85-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:434dd23e972b0c89e128f2ebbd16b38075d609184f4f1fd16368035f923019c2"}, @@ -167,6 +177,7 @@ version = "24.10.0" description = "The uncompromising code formatter." optional = false python-versions = ">=3.9" +groups = ["dev"] files = [ {file = "black-24.10.0-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:e6668650ea4b685440857138e5fe40cde4d652633b1bdffc62933d0db4ed9812"}, {file = "black-24.10.0-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:1c536fcf674217e87b8cc3657b81809d3c085d7bf3ef262ead700da345bfa6ea"}, @@ -213,6 +224,7 @@ version = "6.2.0" description = "An easy safelist-based HTML-sanitizing tool." optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "bleach-6.2.0-py3-none-any.whl", hash = "sha256:117d9c6097a7c3d22fd578fcd8d35ff1e125df6736f554da4e432fdd63f31e5e"}, {file = "bleach-6.2.0.tar.gz", hash = "sha256:123e894118b8a599fd80d3ec1a6d4cc7ce4e5882b1317a7e1ba69b56e95f991f"}, @@ -231,6 +243,8 @@ version = "1.0.5" description = "Python implementation of codon adaptation index" optional = true python-versions = ">=3.8" +groups = ["main"] +markers = "extra == \"express\"" files = [ {file = "cai2-1.0.5-py3-none-any.whl", hash = "sha256:1a9b30b7006defa868e9aabbc1b0ab2e53bc466c3f5b15c41228ba7853babf5f"}, {file = "cai2-1.0.5.tar.gz", hash = "sha256:44cd23f4939f29b48b72f7c9d882f0c4b41f500a528f82a585c1425011398bbd"}, @@ -247,10 +261,12 @@ version = "2024.12.14" description = "Python package for providing Mozilla's CA Bundle." optional = false python-versions = ">=3.6" +groups = ["main", "docs", "test"] files = [ {file = "certifi-2024.12.14-py3-none-any.whl", hash = "sha256:1275f7a45be9464efc1173084eaa30f866fe2e47d389406136d332ed4967ec56"}, {file = "certifi-2024.12.14.tar.gz", hash = "sha256:b650d30f370c2b724812bee08008be0c4163b163ddaec3f2546c1caf65f191db"}, ] +markers = {main = "extra == \"download\""} [[package]] name = "cffi" @@ -258,6 +274,8 @@ version = "1.17.1" description = "Foreign Function Interface for Python calling C code." optional = false python-versions = ">=3.8" +groups = ["docs", "test"] +markers = "implementation_name == \"pypy\"" files = [ {file = "cffi-1.17.1-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:df8b1c11f177bc2313ec4b2d46baec87a5f3e71fc8b45dab2ee7cae86d9aba14"}, {file = "cffi-1.17.1-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:8f2cdc858323644ab277e9bb925ad72ae0e67f69e804f4898c070998d50b1a67"}, @@ -337,6 +355,7 @@ version = "3.4.0" description = "Validate configuration and produce human readable error messages." optional = false python-versions = ">=3.8" +groups = ["dev"] files = [ {file = "cfgv-3.4.0-py2.py3-none-any.whl", hash = "sha256:b7265b1f29fd3316bfcd2b330d63d024f2bfd8bcb8b0272f8e19a504856c48f9"}, {file = "cfgv-3.4.0.tar.gz", hash = "sha256:e52591d4c5f5dead8e0f673fb16db7949d2cfb3f7da4582893288f0ded8fe560"}, @@ -348,6 +367,7 @@ version = "3.4.1" description = "The Real First Universal Charset Detector. Open, modern and actively maintained alternative to Chardet." optional = false python-versions = ">=3.7" +groups = ["main", "docs", "test"] files = [ {file = "charset_normalizer-3.4.1-cp310-cp310-macosx_10_9_universal2.whl", hash = "sha256:91b36a978b5ae0ee86c394f5a54d6ef44db1de0815eb43de826d41d21e4af3de"}, {file = "charset_normalizer-3.4.1-cp310-cp310-manylinux_2_17_aarch64.manylinux2014_aarch64.whl", hash = "sha256:7461baadb4dc00fd9e0acbe254e3d7d2112e7f92ced2adc96e54ef6501c5f176"}, @@ -442,6 +462,7 @@ files = [ {file = "charset_normalizer-3.4.1-py3-none-any.whl", hash = "sha256:d98b1668f06378c6dbefec3b92299716b931cd4e6061f3c875a71ced1780ab85"}, {file = "charset_normalizer-3.4.1.tar.gz", hash = "sha256:44251f18cd68a75b56585dd00dae26183e102cd5e0f9f1466e6df5da2ed64ea3"}, ] +markers = {main = "extra == \"download\""} [[package]] name = "click" @@ -449,10 +470,12 @@ version = "8.1.8" description = "Composable command line interface toolkit" optional = false python-versions = ">=3.7" +groups = ["main", "dev"] files = [ {file = "click-8.1.8-py3-none-any.whl", hash = "sha256:63c132bbbed01578a06712a2d1f497bb62d9c1c0d329b7903a866228027263b2"}, {file = "click-8.1.8.tar.gz", hash = "sha256:ed53c9d8990d83c2a27deae68e4ee337473f6330c040a31d4225c9574d16096a"}, ] +markers = {main = "extra == \"express\""} [package.dependencies] colorama = {version = "*", markers = "platform_system == \"Windows\""} @@ -463,10 +486,12 @@ version = "0.4.6" description = "Cross-platform colored terminal text." optional = false python-versions = "!=3.0.*,!=3.1.*,!=3.2.*,!=3.3.*,!=3.4.*,!=3.5.*,!=3.6.*,>=2.7" +groups = ["main", "dev", "docs", "test"] files = [ {file = "colorama-0.4.6-py2.py3-none-any.whl", hash = "sha256:4f1d9991f5acc0ca119f9d443620b77f9d6b33703e51011c16baf57afb285fc6"}, {file = "colorama-0.4.6.tar.gz", hash = "sha256:08695f5cb7ed6e0531a20572697297273c47b8cae5a63ffc6d6ed5c201be6e44"}, ] +markers = {main = "extra == \"express\" and platform_system == \"Windows\"", dev = "platform_system == \"Windows\"", test = "sys_platform == \"win32\""} [[package]] name = "comm" @@ -474,6 +499,7 @@ version = "0.2.2" description = "Jupyter Python Comm implementation, for usage in ipykernel, xeus-python etc." optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "comm-0.2.2-py3-none-any.whl", hash = "sha256:e6fb86cb70ff661ee8c9c14e7d36d6de3b4066f1441be4063df9c5009f0a64d3"}, {file = "comm-0.2.2.tar.gz", hash = "sha256:3fd7a84065306e07bea1773df6eb8282de51ba82f77c72f9c85716ab11fe980e"}, @@ -491,6 +517,8 @@ version = "1.3.0" description = "Python library for calculating contours of 2D quadrilateral grids" optional = true python-versions = ">=3.9" +groups = ["main"] +markers = "extra == \"gel\"" files = [ {file = "contourpy-1.3.0-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:880ea32e5c774634f9fcd46504bf9f080a41ad855f4fef54f5380f5133d343c7"}, {file = "contourpy-1.3.0-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:76c905ef940a4474a6289c71d53122a4f77766eef23c03cd57016ce19d0f7b42"}, @@ -575,6 +603,7 @@ version = "7.6.10" description = "Code coverage measurement for Python" optional = false python-versions = ">=3.9" +groups = ["test"] files = [ {file = "coverage-7.6.10-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:5c912978f7fbf47ef99cec50c4401340436d200d41d714c7a4766f377c5b7b78"}, {file = "coverage-7.6.10-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:a01ec4af7dfeb96ff0078ad9a48810bb0cc8abcb0115180c6013a6b26237626c"}, @@ -652,6 +681,8 @@ version = "0.12.1" description = "Composable style cycles" optional = true python-versions = ">=3.8" +groups = ["main"] +markers = "extra == \"gel\"" files = [ {file = "cycler-0.12.1-py3-none-any.whl", hash = "sha256:85cef7cff222d8644161529808465972e51340599459b8ac3ccbac5a854e0d30"}, {file = "cycler-0.12.1.tar.gz", hash = "sha256:88bb128f02ba341da8ef447245a9e138fae777f6a23943da4540077d3601eb1c"}, @@ -667,6 +698,7 @@ version = "1.8.12" description = "An implementation of the Debug Adapter Protocol for Python" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "debugpy-1.8.12-cp310-cp310-macosx_14_0_x86_64.whl", hash = "sha256:a2ba7ffe58efeae5b8fad1165357edfe01464f9aef25e814e891ec690e7dd82a"}, {file = "debugpy-1.8.12-cp310-cp310-manylinux_2_5_x86_64.manylinux1_x86_64.manylinux_2_17_x86_64.manylinux2014_x86_64.whl", hash = "sha256:cbbd4149c4fc5e7d508ece083e78c17442ee13b0e69bfa6bd63003e486770f45"}, @@ -702,6 +734,7 @@ version = "5.1.1" description = "Decorators for Humans" optional = false python-versions = ">=3.5" +groups = ["test"] files = [ {file = "decorator-5.1.1-py3-none-any.whl", hash = "sha256:b8c3f85900b9dc423225913c5aace94729fe1fa9763b38939a95226f02d37186"}, {file = "decorator-5.1.1.tar.gz", hash = "sha256:637996211036b6385ef91435e4fae22989472f9d571faba8927ba8253acbc330"}, @@ -713,6 +746,7 @@ version = "0.7.1" description = "XML bomb protection for Python stdlib modules" optional = false python-versions = ">=2.7, !=3.0.*, !=3.1.*, !=3.2.*, !=3.3.*, !=3.4.*" +groups = ["docs"] files = [ {file = "defusedxml-0.7.1-py2.py3-none-any.whl", hash = "sha256:a352e7e428770286cc899e2542b6cdaedb2b4953ff269a210103ec58f6198a61"}, {file = "defusedxml-0.7.1.tar.gz", hash = "sha256:1bb3032db185915b62d7c6209c5a8792be6a32ab2fedacc84e01b52c51aa3e69"}, @@ -724,6 +758,7 @@ version = "0.3.9" description = "Distribution utilities" optional = false python-versions = "*" +groups = ["dev"] files = [ {file = "distlib-0.3.9-py2.py3-none-any.whl", hash = "sha256:47f8c22fd27c27e25a65601af709b38e4f0a45ea4fc2e710f65755fa8caaaf87"}, {file = "distlib-0.3.9.tar.gz", hash = "sha256:a60f20dea646b8a33f3e7772f74dc0b2d0772d2837ee1342a00645c81edf9403"}, @@ -735,6 +770,7 @@ version = "0.21.2" description = "Docutils -- Python Documentation Utilities" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "docutils-0.21.2-py3-none-any.whl", hash = "sha256:dafca5b9e384f0e419294eb4d2ff9fa826435bf15f15b7bd45723e8ad76811b2"}, {file = "docutils-0.21.2.tar.gz", hash = "sha256:3a6b18732edf182daa3cd12775bbb338cf5691468f91eeeb109deff6ebfa986f"}, @@ -746,6 +782,8 @@ version = "1.2.2" description = "Backport of PEP 654 (exception groups)" optional = false python-versions = ">=3.7" +groups = ["test"] +markers = "python_version < \"3.11\"" files = [ {file = "exceptiongroup-1.2.2-py3-none-any.whl", hash = "sha256:3111b9d131c238bec2f8f516e123e14ba243563fb135d3fe885990585aa7795b"}, {file = "exceptiongroup-1.2.2.tar.gz", hash = "sha256:47c2edf7c6738fafb49fd34290706d1a1a2f4d1c6df275526b62cbb4aa5393cc"}, @@ -760,6 +798,7 @@ version = "2.2.0" description = "Get the currently executing AST node of a frame, and other information" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "executing-2.2.0-py2.py3-none-any.whl", hash = "sha256:11387150cad388d62750327a53d3339fad4888b39a6fe233c3afbb54ecffd3aa"}, {file = "executing-2.2.0.tar.gz", hash = "sha256:5d108c028108fe2551d1a7b2e8b713341e2cb4fc0aa7dcf966fa4327a5226755"}, @@ -774,6 +813,7 @@ version = "2.21.1" description = "Fastest Python implementation of JSON schema" optional = false python-versions = "*" +groups = ["dev", "docs", "test"] files = [ {file = "fastjsonschema-2.21.1-py3-none-any.whl", hash = "sha256:c9e5b7e908310918cf494a434eeb31384dd84a98b57a30bcb1f535015b554667"}, {file = "fastjsonschema-2.21.1.tar.gz", hash = "sha256:794d4f0a58f848961ba16af7b9c85a3e88cd360df008c59aac6fc5ae9323b5d4"}, @@ -788,6 +828,7 @@ version = "3.17.0" description = "A platform independent file lock." optional = false python-versions = ">=3.9" +groups = ["dev"] files = [ {file = "filelock-3.17.0-py3-none-any.whl", hash = "sha256:533dc2f7ba78dc2f0f531fc6c4940addf7b70a481e269a5a3b93be94ffbe8338"}, {file = "filelock-3.17.0.tar.gz", hash = "sha256:ee4e77401ef576ebb38cd7f13b9b28893194acc20a8e68e18730ba9c0e54660e"}, @@ -804,6 +845,7 @@ version = "7.1.1" description = "the modular source code checker: pep8 pyflakes and co" optional = false python-versions = ">=3.8.1" +groups = ["dev"] files = [ {file = "flake8-7.1.1-py2.py3-none-any.whl", hash = "sha256:597477df7860daa5aa0fdd84bf5208a043ab96b8e96ab708770ae0364dd03213"}, {file = "flake8-7.1.1.tar.gz", hash = "sha256:049d058491e228e03e67b390f311bbf88fce2dbaa8fa673e7aea87b7198b8d38"}, @@ -820,6 +862,7 @@ version = "24.12.12" description = "A plugin for flake8 finding likely bugs and design problems in your program. Contains warnings that don't belong in pyflakes and pycodestyle." optional = false python-versions = ">=3.8.1" +groups = ["dev"] files = [ {file = "flake8_bugbear-24.12.12-py3-none-any.whl", hash = "sha256:1b6967436f65ca22a42e5373aaa6f2d87966ade9aa38d4baf2a1be550767545e"}, {file = "flake8_bugbear-24.12.12.tar.gz", hash = "sha256:46273cef0a6b6ff48ca2d69e472f41420a42a46e24b2a8972e4f0d6733d12a64"}, @@ -838,6 +881,8 @@ version = "4.55.5" description = "Tools to manipulate font files" optional = true python-versions = ">=3.8" +groups = ["main"] +markers = "extra == \"gel\"" files = [ {file = "fonttools-4.55.5-cp310-cp310-macosx_10_9_universal2.whl", hash = "sha256:58fbc0dba6c87a9ec57be7e6751a6442911e546750e362b39ff07e30445c355f"}, {file = "fonttools-4.55.5-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:b788742d99e7e62b3428728f3af743c6e169b53796c2b885adb0080c256c523e"}, @@ -911,6 +956,7 @@ version = "2024.6.6" description = "Generate a dot graph from the output of several profilers." optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "gprof2dot-2024.6.6-py2.py3-none-any.whl", hash = "sha256:45b14ad7ce64e299c8f526881007b9eb2c6b75505d5613e96e66ee4d5ab33696"}, {file = "gprof2dot-2024.6.6.tar.gz", hash = "sha256:fa1420c60025a9eb7734f65225b4da02a10fc6dd741b37fa129bc6b41951e5ab"}, @@ -922,6 +968,7 @@ version = "2.6.6" description = "File identification library for Python" optional = false python-versions = ">=3.9" +groups = ["dev"] files = [ {file = "identify-2.6.6-py2.py3-none-any.whl", hash = "sha256:cbd1810bce79f8b671ecb20f53ee0ae8e86ae84b557de31d89709dc2a48ba881"}, {file = "identify-2.6.6.tar.gz", hash = "sha256:7bec12768ed44ea4761efb47806f0a41f86e7c0a5fdf5950d4648c90eca7e251"}, @@ -936,10 +983,12 @@ version = "3.10" description = "Internationalized Domain Names in Applications (IDNA)" optional = false python-versions = ">=3.6" +groups = ["main", "docs", "test"] files = [ {file = "idna-3.10-py3-none-any.whl", hash = "sha256:946d195a0d259cbba61165e88e65941f16e9b36ea6ddb97f00452bae8b1287d3"}, {file = "idna-3.10.tar.gz", hash = "sha256:12f65c9b470abda6dc35cf8e63cc574b1c52b11df2c86030af0ac09b01b13ea9"}, ] +markers = {main = "extra == \"download\""} [package.extras] all = ["flake8 (>=7.1.1)", "mypy (>=1.11.2)", "pytest (>=8.3.2)", "ruff (>=0.6.2)"] @@ -950,6 +999,7 @@ version = "1.4.1" description = "Getting image size from png/jpeg/jpeg2000/gif file" optional = false python-versions = ">=2.7, !=3.0.*, !=3.1.*, !=3.2.*, !=3.3.*" +groups = ["docs"] files = [ {file = "imagesize-1.4.1-py2.py3-none-any.whl", hash = "sha256:0d8d18d08f840c19d0ee7ca1fd82490fdc3729b7ac93f49870406ddde8ef8d8b"}, {file = "imagesize-1.4.1.tar.gz", hash = "sha256:69150444affb9cb0d5cc5a92b3676f0b2fb7cd9ae39e947a5e11a36b4497cd4a"}, @@ -961,6 +1011,8 @@ version = "8.6.1" description = "Read metadata from Python packages" optional = false python-versions = ">=3.9" +groups = ["docs", "test"] +markers = "python_version < \"3.10\"" files = [ {file = "importlib_metadata-8.6.1-py3-none-any.whl", hash = "sha256:02a89390c1e15fdfdc0d7c6b25cb3e62650d0494005c97d6f148bf5b9787525e"}, {file = "importlib_metadata-8.6.1.tar.gz", hash = "sha256:310b41d755445d74569f993ccfc22838295d9fe005425094fad953d7f15c8580"}, @@ -984,6 +1036,8 @@ version = "6.5.2" description = "Read resources from Python packages" optional = true python-versions = ">=3.9" +groups = ["main"] +markers = "extra == \"gel\" and python_version < \"3.10\"" files = [ {file = "importlib_resources-6.5.2-py3-none-any.whl", hash = "sha256:789cfdc3ed28c78b67a06acb8126751ced69a3d5f79c095a98298cd8a760ccec"}, {file = "importlib_resources-6.5.2.tar.gz", hash = "sha256:185f87adef5bcc288449d98fb4fba07cea78bc036455dd44c5fc4a2fe78fed2c"}, @@ -1006,6 +1060,7 @@ version = "2.0.0" description = "brain-dead simple config-ini parsing" optional = false python-versions = ">=3.7" +groups = ["test"] files = [ {file = "iniconfig-2.0.0-py3-none-any.whl", hash = "sha256:b6a85871a79d2e3b22d2d1b94ac2824226a63c6b741c88f7ae975f18b6778374"}, {file = "iniconfig-2.0.0.tar.gz", hash = "sha256:2d91e135bf72d31a410b17c16da610a82cb55f6b0477d1a902134b24a455b8b3"}, @@ -1017,6 +1072,7 @@ version = "6.29.5" description = "IPython Kernel for Jupyter" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "ipykernel-6.29.5-py3-none-any.whl", hash = "sha256:afdb66ba5aa354b09b91379bac28ae4afebbb30e8b39510c9690afb7a10421b5"}, {file = "ipykernel-6.29.5.tar.gz", hash = "sha256:f093a22c4a40f8828f8e330a9c297cb93dcab13bd9678ded6de8e5cf81c56215"}, @@ -1050,6 +1106,7 @@ version = "8.18.1" description = "IPython: Productive Interactive Computing" optional = false python-versions = ">=3.9" +groups = ["test"] files = [ {file = "ipython-8.18.1-py3-none-any.whl", hash = "sha256:e8267419d72d81955ec1177f8a29aaa90ac80ad647499201119e2f05e99aa397"}, {file = "ipython-8.18.1.tar.gz", hash = "sha256:ca6f079bb33457c66e233e4580ebfc4128855b4cf6370dddd73842a9563e8a27"}, @@ -1087,6 +1144,7 @@ version = "0.19.2" description = "An autocompletion tool for Python that can be used for text editors." optional = false python-versions = ">=3.6" +groups = ["test"] files = [ {file = "jedi-0.19.2-py2.py3-none-any.whl", hash = "sha256:a8ef22bde8490f57fe5c7681a3c83cb58874daf72b4784de3cce5b6ef6edb5b9"}, {file = "jedi-0.19.2.tar.gz", hash = "sha256:4770dc3de41bde3966b02eb84fbcf557fb33cce26ad23da12c742fb50ecb11f0"}, @@ -1106,6 +1164,7 @@ version = "3.1.5" description = "A very fast and expressive template engine." optional = false python-versions = ">=3.7" +groups = ["docs"] files = [ {file = "jinja2-3.1.5-py3-none-any.whl", hash = "sha256:aba0f4dc9ed8013c424088f68a5c226f7d6097ed89b246d7749c2ec4175c6adb"}, {file = "jinja2-3.1.5.tar.gz", hash = "sha256:8fefff8dc3034e27bb80d67c671eb8a9bc424c0ef4c0826edbff304cceff43bb"}, @@ -1123,6 +1182,7 @@ version = "4.23.0" description = "An implementation of JSON Schema validation for Python" optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "jsonschema-4.23.0-py3-none-any.whl", hash = "sha256:fbadb6f8b144a8f8cf9f0b89ba94501d143e50411a1278633f56a7acf7fd5566"}, {file = "jsonschema-4.23.0.tar.gz", hash = "sha256:d71497fef26351a33265337fa77ffeb82423f3ea21283cd9467bb03999266bc4"}, @@ -1144,6 +1204,7 @@ version = "2024.10.1" description = "The JSON Schema meta-schemas and vocabularies, exposed as a Registry" optional = false python-versions = ">=3.9" +groups = ["dev", "docs", "test"] files = [ {file = "jsonschema_specifications-2024.10.1-py3-none-any.whl", hash = "sha256:a09a0680616357d9a0ecf05c12ad234479f549239d0f5b55f3deea67475da9bf"}, {file = "jsonschema_specifications-2024.10.1.tar.gz", hash = "sha256:0f38b83639958ce1152d02a7f062902c41c8fd20d558b0c34344292d417ae272"}, @@ -1158,6 +1219,7 @@ version = "8.6.3" description = "Jupyter protocol implementation and client libraries" optional = false python-versions = ">=3.8" +groups = ["docs", "test"] files = [ {file = "jupyter_client-8.6.3-py3-none-any.whl", hash = "sha256:e8a19cc986cc45905ac3362915f410f3af85424b4c0905e94fa5f2cb08e8f23f"}, {file = "jupyter_client-8.6.3.tar.gz", hash = "sha256:35b3a0947c4a6e9d589eb97d7d4cd5e90f910ee73101611f01283732bd6d9419"}, @@ -1181,6 +1243,7 @@ version = "5.7.2" description = "Jupyter core package. A base package on which Jupyter projects rely." optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "jupyter_core-5.7.2-py3-none-any.whl", hash = "sha256:4f7315d2f6b4bcf2e3e7cb6e46772eba760ae459cd1f59d29eb57b0a01bd7409"}, {file = "jupyter_core-5.7.2.tar.gz", hash = "sha256:aa5f8d32bbf6b431ac830496da7392035d6f61b4f54872f15c4bd2a9c3f536d9"}, @@ -1201,6 +1264,7 @@ version = "0.3.0" description = "Pygments theme using JupyterLab CSS variables" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "jupyterlab_pygments-0.3.0-py3-none-any.whl", hash = "sha256:841a89020971da1d8693f1a99997aefc5dc424bb1b251fd6322462a1b8842780"}, {file = "jupyterlab_pygments-0.3.0.tar.gz", hash = "sha256:721aca4d9029252b11cfa9d185e5b5af4d54772bb8072f9b7036f4170054d35d"}, @@ -1212,6 +1276,8 @@ version = "1.4.7" description = "A fast implementation of the Cassowary constraint solver" optional = true python-versions = ">=3.8" +groups = ["main"] +markers = "extra == \"gel\"" files = [ {file = "kiwisolver-1.4.7-cp310-cp310-macosx_10_9_universal2.whl", hash = "sha256:8a9c83f75223d5e48b0bc9cb1bf2776cf01563e00ade8775ffe13b0b6e1af3a6"}, {file = "kiwisolver-1.4.7-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:58370b1ffbd35407444d57057b57da5d6549d2d854fa30249771775c63b5fe17"}, @@ -1335,6 +1401,7 @@ version = "2.7.1" description = "Python LiveReload is an awesome tool for web developers" optional = false python-versions = ">=3.7" +groups = ["docs"] files = [ {file = "livereload-2.7.1-py3-none-any.whl", hash = "sha256:5201740078c1b9433f4b2ba22cd2729a39b9d0ec0a2cc6b4d3df257df5ad0564"}, {file = "livereload-2.7.1.tar.gz", hash = "sha256:3d9bf7c05673df06e32bea23b494b8d36ca6d10f7d5c3c8a6989608c09c986a9"}, @@ -1349,6 +1416,7 @@ version = "3.0.0" description = "Python port of markdown-it. Markdown parsing, done right!" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "markdown-it-py-3.0.0.tar.gz", hash = "sha256:e3f60a94fa066dc52ec76661e37c851cb232d92f9886b15cb560aaada2df8feb"}, {file = "markdown_it_py-3.0.0-py3-none-any.whl", hash = "sha256:355216845c60bd96232cd8d8c40e8f9765cc86f46880e43a8fd22dc1a1a8cab1"}, @@ -1373,6 +1441,7 @@ version = "3.0.2" description = "Safely add untrusted strings to HTML/XML markup." optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "MarkupSafe-3.0.2-cp310-cp310-macosx_10_9_universal2.whl", hash = "sha256:7e94c425039cde14257288fd61dcfb01963e658efbc0ff54f5306b06054700f8"}, {file = "MarkupSafe-3.0.2-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:9e2d922824181480953426608b81967de705c3cef4d1af983af849d7bd619158"}, @@ -1443,6 +1512,8 @@ version = "3.9.4" description = "Python plotting package" optional = true python-versions = ">=3.9" +groups = ["main"] +markers = "extra == \"gel\"" files = [ {file = "matplotlib-3.9.4-cp310-cp310-macosx_10_12_x86_64.whl", hash = "sha256:c5fdd7abfb706dfa8d307af64a87f1a862879ec3cd8d0ec8637458f0885b9c50"}, {file = "matplotlib-3.9.4-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:d89bc4e85e40a71d1477780366c27fb7c6494d293e1617788986f74e2a03d7ff"}, @@ -1508,6 +1579,7 @@ version = "0.1.7" description = "Inline Matplotlib backend for Jupyter" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "matplotlib_inline-0.1.7-py3-none-any.whl", hash = "sha256:df192d39a4ff8f21b1895d72e6a13f5fcc5099f00fa84384e0ea28c2cc0653ca"}, {file = "matplotlib_inline-0.1.7.tar.gz", hash = "sha256:8423b23ec666be3d16e16b60bdd8ac4e86e840ebd1dd11a30b9f117f2fa0ab90"}, @@ -1522,6 +1594,7 @@ version = "0.7.0" description = "McCabe checker, plugin for flake8" optional = false python-versions = ">=3.6" +groups = ["dev"] files = [ {file = "mccabe-0.7.0-py2.py3-none-any.whl", hash = "sha256:6c2d30ab6be0e4a46919781807b4f0d834ebdd6c6e3dca0bda5a15f863427b6e"}, {file = "mccabe-0.7.0.tar.gz", hash = "sha256:348e0240c33b60bbdf4e523192ef919f28cb2c3d7d5c7794f74009290f236325"}, @@ -1533,6 +1606,7 @@ version = "0.4.2" description = "Collection of plugins for markdown-it-py" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "mdit_py_plugins-0.4.2-py3-none-any.whl", hash = "sha256:0c673c3f889399a33b95e88d2f0d111b4447bdfea7f237dab2d488f459835636"}, {file = "mdit_py_plugins-0.4.2.tar.gz", hash = "sha256:5f2cd1fdb606ddf152d37ec30e46101a60512bc0e5fa1a7002c36647b09e26b5"}, @@ -1552,6 +1626,7 @@ version = "0.1.2" description = "Markdown URL utilities" optional = false python-versions = ">=3.7" +groups = ["docs"] files = [ {file = "mdurl-0.1.2-py3-none-any.whl", hash = "sha256:84008a41e51615a49fc9966191ff91509e3c40b939176e643fd50a5c2196b8f8"}, {file = "mdurl-0.1.2.tar.gz", hash = "sha256:bb413d29f5eea38f31dd4754dd7377d4465116fb207585f97bf925588687c1ba"}, @@ -1563,6 +1638,7 @@ version = "3.1.0" description = "A sane and fast Markdown parser with useful plugins and renderers" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "mistune-3.1.0-py3-none-any.whl", hash = "sha256:b05198cf6d671b3deba6c87ec6cf0d4eb7b72c524636eddb6dbf13823b52cee1"}, {file = "mistune-3.1.0.tar.gz", hash = "sha256:dbcac2f78292b9dc066cd03b7a3a26b62d85f8159f2ea5fd28e55df79908d667"}, @@ -1577,6 +1653,7 @@ version = "1.0.0" description = "Type system extensions for programs checked with the mypy type checker." optional = false python-versions = ">=3.5" +groups = ["dev"] files = [ {file = "mypy_extensions-1.0.0-py3-none-any.whl", hash = "sha256:4392f6c0eb8a5668a69e23d168ffa70f0be9ccfd32b5cc2d26a34ae5b844552d"}, {file = "mypy_extensions-1.0.0.tar.gz", hash = "sha256:75dbf8955dc00442a438fc4d0666508a9a97b6bd41aa2f0ffe9d2f2725af0782"}, @@ -1588,6 +1665,8 @@ version = "3.0.1" description = "An extended [CommonMark](https://spec.commonmark.org/) compliant parser," optional = false python-versions = ">=3.8" +groups = ["docs"] +markers = "python_version < \"3.10\"" files = [ {file = "myst_parser-3.0.1-py3-none-any.whl", hash = "sha256:6457aaa33a5d474aca678b8ead9b3dc298e89c68e67012e73146ea6fd54babf1"}, {file = "myst_parser-3.0.1.tar.gz", hash = "sha256:88f0cb406cb363b077d176b51c476f62d60604d68a8dcdf4832e080441301a87"}, @@ -1614,6 +1693,8 @@ version = "4.0.0" description = "An extended [CommonMark](https://spec.commonmark.org/) compliant parser," optional = false python-versions = ">=3.10" +groups = ["docs"] +markers = "python_version >= \"3.10\"" files = [ {file = "myst_parser-4.0.0-py3-none-any.whl", hash = "sha256:b9317997552424448c6096c2558872fdb6f81d3ecb3a40ce84a7518798f3f28d"}, {file = "myst_parser-4.0.0.tar.gz", hash = "sha256:851c9dfb44e36e56d15d05e72f02b80da21a9e0d07cba96baf5e2d476bb91531"}, @@ -1640,6 +1721,7 @@ version = "0.10.2" description = "A client library for executing notebooks. Formerly nbconvert's ExecutePreprocessor." optional = false python-versions = ">=3.9.0" +groups = ["docs"] files = [ {file = "nbclient-0.10.2-py3-none-any.whl", hash = "sha256:4ffee11e788b4a27fabeb7955547e4318a5298f34342a4bfd01f2e1faaeadc3d"}, {file = "nbclient-0.10.2.tar.gz", hash = "sha256:90b7fc6b810630db87a6d0c2250b1f0ab4cf4d3c27a299b0cde78a4ed3fd9193"}, @@ -1662,6 +1744,7 @@ version = "7.16.5" description = "Converting Jupyter Notebooks (.ipynb files) to other formats. Output formats include asciidoc, html, latex, markdown, pdf, py, rst, script. nbconvert can be used both as a Python library (`import nbconvert`) or as a command line tool (invoked as `jupyter nbconvert ...`)." optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "nbconvert-7.16.5-py3-none-any.whl", hash = "sha256:e12eac052d6fd03040af4166c563d76e7aeead2e9aadf5356db552a1784bd547"}, {file = "nbconvert-7.16.5.tar.gz", hash = "sha256:c83467bb5777fdfaac5ebbb8e864f300b277f68692ecc04d6dab72f2d8442344"}, @@ -1699,6 +1782,7 @@ version = "5.10.4" description = "The Jupyter Notebook format" optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "nbformat-5.10.4-py3-none-any.whl", hash = "sha256:3b48d6c8fbca4b299bf3982ea7db1af21580e4fec269ad087b9e81588891200b"}, {file = "nbformat-5.10.4.tar.gz", hash = "sha256:322168b14f937a5d11362988ecac2a4952d3d8e3a2cbeb2319584631226d5b3a"}, @@ -1720,6 +1804,7 @@ version = "0.7.1" description = "Strips outputs from Jupyter and IPython notebooks" optional = false python-versions = ">=3.8" +groups = ["dev"] files = [ {file = "nbstripout-0.7.1-py2.py3-none-any.whl", hash = "sha256:dfb0688b42b02ff13925e583313fc009c87342ad13b79ae0329357749aa6ed0c"}, {file = "nbstripout-0.7.1.tar.gz", hash = "sha256:2aad3454dc13e356f2fc94917856bc44f2bed3add77e8ba9f3a78003074bcd84"}, @@ -1734,6 +1819,7 @@ version = "0.11.0" description = "A py.test plugin to validate Jupyter notebooks" optional = false python-versions = ">=3.7, <4" +groups = ["test"] files = [ {file = "nbval-0.11.0-py2.py3-none-any.whl", hash = "sha256:307aecc866c9a1e8a13bb5bbb008a702bacfda2394dff6fe504a3108a58042a0"}, {file = "nbval-0.11.0.tar.gz", hash = "sha256:77c95797607b0a968babd2597ee3494102d25c3ad37435debbdac0e46e379094"}, @@ -1752,6 +1838,7 @@ version = "1.6.0" description = "Patch asyncio to allow nested event loops" optional = false python-versions = ">=3.5" +groups = ["test"] files = [ {file = "nest_asyncio-1.6.0-py3-none-any.whl", hash = "sha256:87af6efd6b5e897c81050477ef65c62e2b2f35d51703cae01aff2905b1852e1c"}, {file = "nest_asyncio-1.6.0.tar.gz", hash = "sha256:6f172d5449aca15afd6c646851f4e31e02c598d553a667e38cafa997cfec55fe"}, @@ -1763,6 +1850,7 @@ version = "3.2.1" description = "Python package for creating and manipulating graphs and networks" optional = false python-versions = ">=3.9" +groups = ["main"] files = [ {file = "networkx-3.2.1-py3-none-any.whl", hash = "sha256:f18c69adc97877c42332c170849c96cefa91881c99a7cb3e95b7c659ebdc1ec2"}, {file = "networkx-3.2.1.tar.gz", hash = "sha256:9f1bb5cf3409bf324e0a722c20bdb4c20ee39bf1c30ce8ae499c8502b0b5e0c6"}, @@ -1781,6 +1869,7 @@ version = "1.9.1" description = "Node.js virtual environment builder" optional = false python-versions = "!=3.0.*,!=3.1.*,!=3.2.*,!=3.3.*,!=3.4.*,!=3.5.*,!=3.6.*,>=2.7" +groups = ["dev"] files = [ {file = "nodeenv-1.9.1-py2.py3-none-any.whl", hash = "sha256:ba11c9782d29c27c70ffbdda2d7415098754709be8a7056d79a737cd901155c9"}, {file = "nodeenv-1.9.1.tar.gz", hash = "sha256:6ec12890a2dab7946721edbfbcd91f3319c6ccc9aec47be7c7e6b7011ee6645f"}, @@ -1792,6 +1881,7 @@ version = "2.0.2" description = "Fundamental package for array computing in Python" optional = false python-versions = ">=3.9" +groups = ["main"] files = [ {file = "numpy-2.0.2-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:51129a29dbe56f9ca83438b706e2e69a39892b5eda6cedcb6b0c9fdc9b0d3ece"}, {file = "numpy-2.0.2-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:f15975dfec0cf2239224d80e32c3170b1d168335eaedee69da84fbe9f1f9cd04"}, @@ -1846,6 +1936,7 @@ version = "1.8.0" description = "Sphinx extension to support docstrings in Numpy format" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "numpydoc-1.8.0-py3-none-any.whl", hash = "sha256:72024c7fd5e17375dec3608a27c03303e8ad00c81292667955c6fea7a3ccf541"}, {file = "numpydoc-1.8.0.tar.gz", hash = "sha256:022390ab7464a44f8737f79f8b31ce1d3cfa4b4af79ccaa1aac5e8368db587fb"}, @@ -1867,10 +1958,12 @@ version = "24.2" description = "Core utilities for Python packages" optional = false python-versions = ">=3.8" +groups = ["main", "dev", "docs", "test"] files = [ {file = "packaging-24.2-py3-none-any.whl", hash = "sha256:09abb1bccd265c01f4a3aa3f7a7db064b36514d2cba19a2f694fe6150451a759"}, {file = "packaging-24.2.tar.gz", hash = "sha256:c228a6dc5e932d346bc5739379109d49e8853dd8223571c7c5b55260edc0b97f"}, ] +markers = {main = "extra == \"gel\""} [[package]] name = "pandocfilters" @@ -1878,6 +1971,7 @@ version = "1.5.1" description = "Utilities for writing pandoc filters in python" optional = false python-versions = ">=2.7, !=3.0.*, !=3.1.*, !=3.2.*, !=3.3.*" +groups = ["docs"] files = [ {file = "pandocfilters-1.5.1-py2.py3-none-any.whl", hash = "sha256:93be382804a9cdb0a7267585f157e5d1731bbe5545a85b268d6f5fe6232de2bc"}, {file = "pandocfilters-1.5.1.tar.gz", hash = "sha256:002b4a555ee4ebc03f8b66307e287fa492e4a77b4ea14d3f934328297bb4939e"}, @@ -1889,6 +1983,7 @@ version = "0.8.4" description = "A Python Parser" optional = false python-versions = ">=3.6" +groups = ["test"] files = [ {file = "parso-0.8.4-py2.py3-none-any.whl", hash = "sha256:a418670a20291dacd2dddc80c377c5c3791378ee1e8d12bffc35420643d43f18"}, {file = "parso-0.8.4.tar.gz", hash = "sha256:eb3a7b58240fb99099a345571deecc0f9540ea5f4dd2fe14c2a99d6b281ab92d"}, @@ -1904,6 +1999,7 @@ version = "0.12.1" description = "Utility library for gitignore style pattern matching of file paths." optional = false python-versions = ">=3.8" +groups = ["dev"] files = [ {file = "pathspec-0.12.1-py3-none-any.whl", hash = "sha256:a0d503e138a4c123b27490a4f7beda6a01c6f288df0e4a8b79c7eb0dc7b4cc08"}, {file = "pathspec-0.12.1.tar.gz", hash = "sha256:a482d51503a1ab33b1c67a6c3813a26953dbdc71c31dacaef9a838c4e29f5712"}, @@ -1915,6 +2011,8 @@ version = "4.9.0" description = "Pexpect allows easy control of interactive console applications." optional = false python-versions = "*" +groups = ["test"] +markers = "sys_platform != \"win32\"" files = [ {file = "pexpect-4.9.0-py2.py3-none-any.whl", hash = "sha256:7236d1e080e4936be2dc3e326cec0af72acf9212a7e1d060210e70a47e253523"}, {file = "pexpect-4.9.0.tar.gz", hash = "sha256:ee7d41123f3c9911050ea2c2dac107568dc43b2d3b0c7557a33212c398ead30f"}, @@ -1929,6 +2027,8 @@ version = "11.1.0" description = "Python Imaging Library (Fork)" optional = true python-versions = ">=3.9" +groups = ["main"] +markers = "extra == \"gel\"" files = [ {file = "pillow-11.1.0-cp310-cp310-macosx_10_10_x86_64.whl", hash = "sha256:e1abe69aca89514737465752b4bcaf8016de61b3be1397a8fc260ba33321b3a8"}, {file = "pillow-11.1.0-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:c640e5a06869c75994624551f45e5506e4256562ead981cce820d5ab39ae2192"}, @@ -2017,6 +2117,7 @@ version = "4.3.6" description = "A small Python package for determining appropriate platform-specific dirs, e.g. a `user data dir`." optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "platformdirs-4.3.6-py3-none-any.whl", hash = "sha256:73e575e1408ab8103900836b97580d5307456908a03e92031bab39e4554cc3fb"}, {file = "platformdirs-4.3.6.tar.gz", hash = "sha256:357fb2acbc885b0419afd3ce3ed34564c13c9b95c89360cd9563f73aa5e2b907"}, @@ -2033,6 +2134,7 @@ version = "1.5.0" description = "plugin and hook calling mechanisms for python" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "pluggy-1.5.0-py3-none-any.whl", hash = "sha256:44e1ad92c8ca002de6377e165f3e0f1be63266ab4d554740532335b9d75ea669"}, {file = "pluggy-1.5.0.tar.gz", hash = "sha256:2cffa88e94fdc978c4c574f15f9e59b7f4201d439195c3715ca9e2486f1d0cf1"}, @@ -2048,6 +2150,7 @@ version = "4.1.0" description = "A framework for managing and maintaining multi-language pre-commit hooks." optional = false python-versions = ">=3.9" +groups = ["dev"] files = [ {file = "pre_commit-4.1.0-py2.py3-none-any.whl", hash = "sha256:d29e7cb346295bcc1cc75fc3e92e343495e3ea0196c9ec6ba53f49f10ab6ae7b"}, {file = "pre_commit-4.1.0.tar.gz", hash = "sha256:ae3f018575a588e30dfddfab9a05448bfbd6b73d78709617b5a2b853549716d4"}, @@ -2066,6 +2169,7 @@ version = "3.12.0" description = "A simple Python library for easily displaying tabular data in a visually appealing ASCII table format" optional = false python-versions = ">=3.9" +groups = ["main"] files = [ {file = "prettytable-3.12.0-py3-none-any.whl", hash = "sha256:77ca0ad1c435b6e363d7e8623d7cc4fcf2cf15513bf77a1c1b2e814930ac57cc"}, {file = "prettytable-3.12.0.tar.gz", hash = "sha256:f04b3e1ba35747ac86e96ec33e3bb9748ce08e254dc2a1c6253945901beec804"}, @@ -2083,6 +2187,7 @@ version = "3.0.50" description = "Library for building powerful interactive command lines in Python" optional = false python-versions = ">=3.8.0" +groups = ["test"] files = [ {file = "prompt_toolkit-3.0.50-py3-none-any.whl", hash = "sha256:9b6427eb19e479d98acff65196a307c555eb567989e6d88ebbb1b509d9779198"}, {file = "prompt_toolkit-3.0.50.tar.gz", hash = "sha256:544748f3860a2623ca5cd6d2795e7a14f3d0e1c3c9728359013f79877fc89bab"}, @@ -2097,6 +2202,7 @@ version = "6.1.1" description = "Cross-platform lib for process and system monitoring in Python." optional = false python-versions = "!=3.0.*,!=3.1.*,!=3.2.*,!=3.3.*,!=3.4.*,!=3.5.*,>=2.7" +groups = ["test"] files = [ {file = "psutil-6.1.1-cp27-cp27m-macosx_10_9_x86_64.whl", hash = "sha256:9ccc4316f24409159897799b83004cb1e24f9819b0dcf9c0b68bdcb6cefee6a8"}, {file = "psutil-6.1.1-cp27-cp27m-manylinux2010_i686.whl", hash = "sha256:ca9609c77ea3b8481ab005da74ed894035936223422dc591d6772b147421f777"}, @@ -2127,6 +2233,8 @@ version = "0.7.0" description = "Run a subprocess in a pseudo terminal" optional = false python-versions = "*" +groups = ["test"] +markers = "sys_platform != \"win32\"" files = [ {file = "ptyprocess-0.7.0-py2.py3-none-any.whl", hash = "sha256:4b41f3967fce3af57cc7e94b888626c18bf37a083e3651ca8feeb66d492fef35"}, {file = "ptyprocess-0.7.0.tar.gz", hash = "sha256:5c5d0a3b48ceee0b48485e0c26037c0acd7d29765ca3fbb5cb3831d347423220"}, @@ -2138,6 +2246,7 @@ version = "0.2.3" description = "Safely evaluate AST nodes without side effects" optional = false python-versions = "*" +groups = ["test"] files = [ {file = "pure_eval-0.2.3-py3-none-any.whl", hash = "sha256:1db8e35b67b3d218d818ae653e27f06c3aa420901fa7b081ca98cbedc874e0d0"}, {file = "pure_eval-0.2.3.tar.gz", hash = "sha256:5f4e983f40564c576c7c8635ae88db5956bb2229d7e9237d03b3c0b0190eaf42"}, @@ -2152,6 +2261,7 @@ version = "2.12.1" description = "Python style guide checker" optional = false python-versions = ">=3.8" +groups = ["dev"] files = [ {file = "pycodestyle-2.12.1-py2.py3-none-any.whl", hash = "sha256:46f0fb92069a7c28ab7bb558f05bfc0110dac69a0cd23c61ea0040283a9d78b3"}, {file = "pycodestyle-2.12.1.tar.gz", hash = "sha256:6838eae08bbce4f6accd5d5572075c63626a15ee3e6f842df996bf62f6d73521"}, @@ -2163,6 +2273,8 @@ version = "2.22" description = "C parser in Python" optional = false python-versions = ">=3.8" +groups = ["docs", "test"] +markers = "implementation_name == \"pypy\"" files = [ {file = "pycparser-2.22-py3-none-any.whl", hash = "sha256:c3702b6d3dd8c7abc1afa565d7e63d53a1d0bd86cdc24edd75470f4de499cfcc"}, {file = "pycparser-2.22.tar.gz", hash = "sha256:491c8be9c040f5390f5bf44a5b07752bd07f56edf992381b05c701439eec10f6"}, @@ -2174,6 +2286,7 @@ version = "0.0.18" description = "String algorithms" optional = false python-versions = ">=3.9" +groups = ["main"] files = [ {file = "pydivsufsort-0.0.18-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:40474ee2f071fb16b33082596b35638c2c17eb37d9c0efced8b31394d6e0cacd"}, {file = "pydivsufsort-0.0.18-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:37c660abe0f126111e8e251391a8efc88dcbb726342e18ac230c0ba79f81c1c2"}, @@ -2218,6 +2331,7 @@ version = "0.8.post1" description = "Pure-python FIGlet implementation" optional = false python-versions = "*" +groups = ["main"] files = [ {file = "pyfiglet-0.8.post1-py2.py3-none-any.whl", hash = "sha256:d555bcea17fbeaf70eaefa48bb119352487e629c9b56f30f383e2c62dd67a01c"}, {file = "pyfiglet-0.8.post1.tar.gz", hash = "sha256:c6c2321755d09267b438ec7b936825a4910fec696292139e664ca8670e103639"}, @@ -2229,6 +2343,7 @@ version = "3.2.0" description = "passive checker of Python programs" optional = false python-versions = ">=3.8" +groups = ["dev"] files = [ {file = "pyflakes-3.2.0-py2.py3-none-any.whl", hash = "sha256:84b5be138a2dfbb40689ca07e2152deb896a65c3a3e24c251c5c62489568074a"}, {file = "pyflakes-3.2.0.tar.gz", hash = "sha256:1c61603ff154621fb2a9172037d84dca3500def8c8b630657d1701f026f8af3f"}, @@ -2240,6 +2355,7 @@ version = "2.19.1" description = "Pygments is a syntax highlighting package written in Python." optional = false python-versions = ">=3.8" +groups = ["docs", "test"] files = [ {file = "pygments-2.19.1-py3-none-any.whl", hash = "sha256:9ea1544ad55cecf4b8242fab6dd35a93bbce657034b0611ee383099054ab6d8c"}, {file = "pygments-2.19.1.tar.gz", hash = "sha256:61c16d2a8576dc0649d9f39e089b5f02bcd27fba10d8fb4dcc28173f7a45151f"}, @@ -2254,6 +2370,8 @@ version = "3.2.1" description = "pyparsing module - Classes and methods to define and execute parsing grammars" optional = true python-versions = ">=3.9" +groups = ["main"] +markers = "extra == \"gel\" or extra == \"download\"" files = [ {file = "pyparsing-3.2.1-py3-none-any.whl", hash = "sha256:506ff4f4386c4cec0590ec19e6302d3aedb992fdc02c761e90416f158dacf8e1"}, {file = "pyparsing-3.2.1.tar.gz", hash = "sha256:61980854fd66de3a90028d679a954d5f2623e83144b5afe5ee86f43d762e5f0a"}, @@ -2268,6 +2386,8 @@ version = "1.9.0" description = "A cross-platform clipboard module for Python. (Only handles plain text for now.)" optional = true python-versions = "*" +groups = ["main"] +markers = "extra == \"clipboard\"" files = [ {file = "pyperclip-1.9.0.tar.gz", hash = "sha256:b7de0142ddc81bfc5c7507eea19da920b92252b548b96186caf94a5e2527d310"}, ] @@ -2278,6 +2398,7 @@ version = "8.3.4" description = "pytest: simple powerful testing with Python" optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "pytest-8.3.4-py3-none-any.whl", hash = "sha256:50e16d954148559c9a74109af1eaf0c945ba2d8f30f0a3d3335edde19788b6f6"}, {file = "pytest-8.3.4.tar.gz", hash = "sha256:965370d062bce11e73868e0335abac31b4d3de0e82f4007408d242b4f8610761"}, @@ -2300,6 +2421,7 @@ version = "6.0.0" description = "Pytest plugin for measuring coverage." optional = false python-versions = ">=3.9" +groups = ["test"] files = [ {file = "pytest-cov-6.0.0.tar.gz", hash = "sha256:fde0b595ca248bb8e2d76f020b465f3b107c9632e6a1d1705f17834c89dcadc0"}, {file = "pytest_cov-6.0.0-py3-none-any.whl", hash = "sha256:eee6f1b9e61008bd34975a4d5bab25801eb31898b032dd55addc93e96fcaaa35"}, @@ -2318,6 +2440,7 @@ version = "1.3.0" description = "Pytest plugin with advanced doctest features." optional = false python-versions = ">=3.8" +groups = ["test"] files = [ {file = "pytest_doctestplus-1.3.0-py3-none-any.whl", hash = "sha256:4a7385d3e678881bb960e9200aa0db62ee32d575b3fa10d6735e8f1542c638f8"}, {file = "pytest_doctestplus-1.3.0.tar.gz", hash = "sha256:709ad23ea98da9a835ace0a4365c85371c376e000f2860f30de6df3a6f00728a"}, @@ -2336,6 +2459,7 @@ version = "1.8.1" description = "Profiling plugin for py.test" optional = false python-versions = ">=3.6" +groups = ["test"] files = [ {file = "pytest-profiling-1.8.1.tar.gz", hash = "sha256:3f171fa69d5c82fa9aab76d66abd5f59da69135c37d6ae5bf7557f1b154cb08d"}, {file = "pytest_profiling-1.8.1-py3-none-any.whl", hash = "sha256:3dd8713a96298b42d83de8f5951df3ada3e61b3e5d2a06956684175529e17aea"}, @@ -2352,10 +2476,12 @@ version = "2.9.0.post0" description = "Extensions to the standard Python datetime module" optional = false python-versions = "!=3.0.*,!=3.1.*,!=3.2.*,>=2.7" +groups = ["main", "docs", "test"] files = [ {file = "python-dateutil-2.9.0.post0.tar.gz", hash = "sha256:37dd54208da7e1cd875388217d5e00ebd4179249f90fb72437e91a35459a0ad3"}, {file = "python_dateutil-2.9.0.post0-py2.py3-none-any.whl", hash = "sha256:a8b2bc7bffae282281c8140a97d3aa9c14da0b136dfe83f850eea9a5f7470427"}, ] +markers = {main = "extra == \"gel\""} [package.dependencies] six = ">=1.5" @@ -2366,6 +2492,8 @@ version = "308" description = "Python for Window Extensions" optional = false python-versions = "*" +groups = ["dev", "docs", "test"] +markers = "sys_platform == \"win32\" and platform_python_implementation != \"PyPy\"" files = [ {file = "pywin32-308-cp310-cp310-win32.whl", hash = "sha256:796ff4426437896550d2981b9c2ac0ffd75238ad9ea2d3bfa67a1abd546d262e"}, {file = "pywin32-308-cp310-cp310-win_amd64.whl", hash = "sha256:4fc888c59b3c0bef905ce7eb7e2106a07712015ea1c8234b703a088d46110e8e"}, @@ -2393,6 +2521,7 @@ version = "6.0.2" description = "YAML parser and emitter for Python" optional = false python-versions = ">=3.8" +groups = ["dev", "docs"] files = [ {file = "PyYAML-6.0.2-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:0a9a2848a5b7feac301353437eb7d5957887edbf81d56e903999a75a3d743086"}, {file = "PyYAML-6.0.2-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:29717114e51c84ddfba879543fb232a6ed60086602313ca38cce623c1d62cfbf"}, @@ -2455,6 +2584,7 @@ version = "26.2.0" description = "Python bindings for 0MQ" optional = false python-versions = ">=3.7" +groups = ["docs", "test"] files = [ {file = "pyzmq-26.2.0-cp310-cp310-macosx_10_15_universal2.whl", hash = "sha256:ddf33d97d2f52d89f6e6e7ae66ee35a4d9ca6f36eda89c24591b0c40205a3629"}, {file = "pyzmq-26.2.0-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:dacd995031a01d16eec825bf30802fceb2c3791ef24bcce48fa98ce40918c27b"}, @@ -2576,6 +2706,7 @@ version = "0.36.1" description = "JSON Referencing + Python" optional = false python-versions = ">=3.9" +groups = ["dev", "docs", "test"] files = [ {file = "referencing-0.36.1-py3-none-any.whl", hash = "sha256:363d9c65f080d0d70bc41c721dce3c7f3e77fc09f269cd5c8813da18069a6794"}, {file = "referencing-0.36.1.tar.gz", hash = "sha256:ca2e6492769e3602957e9b831b94211599d2aade9477f5d44110d2530cf9aade"}, @@ -2592,10 +2723,12 @@ version = "2.32.3" description = "Python HTTP for Humans." optional = false python-versions = ">=3.8" +groups = ["main", "docs", "test"] files = [ {file = "requests-2.32.3-py3-none-any.whl", hash = "sha256:70761cfe03c773ceb22aa2f671b4757976145175cdfca038c02654d061d6dcc6"}, {file = "requests-2.32.3.tar.gz", hash = "sha256:55365417734eb18255590a9ff9eb97e9e1da868d4ccd6402399eaf68af20a760"}, ] +markers = {main = "extra == \"download\""} [package.dependencies] certifi = ">=2017.4.17" @@ -2613,6 +2746,7 @@ version = "1.12.1" description = "Mock out responses from the requests package" optional = false python-versions = ">=3.5" +groups = ["test"] files = [ {file = "requests-mock-1.12.1.tar.gz", hash = "sha256:e9e12e333b525156e82a3c852f22016b9158220d2f47454de9cae8a77d371401"}, {file = "requests_mock-1.12.1-py2.py3-none-any.whl", hash = "sha256:b1e37054004cdd5e56c84454cc7df12b25f90f382159087f4b6915aaeef39563"}, @@ -2630,6 +2764,7 @@ version = "0.22.3" description = "Python bindings to Rust's persistent data structures (rpds)" optional = false python-versions = ">=3.9" +groups = ["dev", "docs", "test"] files = [ {file = "rpds_py-0.22.3-cp310-cp310-macosx_10_12_x86_64.whl", hash = "sha256:6c7b99ca52c2c1752b544e310101b98a659b720b21db00e65edca34483259967"}, {file = "rpds_py-0.22.3-cp310-cp310-macosx_11_0_arm64.whl", hash = "sha256:be2eb3f2495ba669d2a985f9b426c1797b7d48d6963899276d22f23e33d47e37"}, @@ -2742,6 +2877,8 @@ version = "1.13.1" description = "Fundamental algorithms for scientific computing in Python" optional = true python-versions = ">=3.9" +groups = ["main"] +markers = "extra == \"express\" or extra == \"gel\"" files = [ {file = "scipy-1.13.1-cp310-cp310-macosx_10_9_x86_64.whl", hash = "sha256:20335853b85e9a49ff7572ab453794298bcf0354d8068c5f6775a0eabf350aca"}, {file = "scipy-1.13.1-cp310-cp310-macosx_12_0_arm64.whl", hash = "sha256:d605e9c23906d1994f55ace80e0125c587f96c020037ea6aa98d01b4bd2e222f"}, @@ -2784,6 +2921,8 @@ version = "1.15.1" description = "Fundamental algorithms for scientific computing in Python" optional = true python-versions = ">=3.10" +groups = ["main"] +markers = "extra == \"express\" and python_version >= \"3.12\" or extra == \"gel\" and python_version >= \"3.12\"" files = [ {file = "scipy-1.15.1-cp310-cp310-macosx_10_13_x86_64.whl", hash = "sha256:c64ded12dcab08afff9e805a67ff4480f5e69993310e093434b10e85dc9d43e1"}, {file = "scipy-1.15.1-cp310-cp310-macosx_12_0_arm64.whl", hash = "sha256:5b190b935e7db569960b48840e5bef71dc513314cc4e79a1b7d14664f57fd4ff"}, @@ -2841,6 +2980,7 @@ version = "0.1.0" description = "Sequence Globally Unique Identifier (SEGUID) Checksums for Linear, Circular, Single-Stranded and Double-Stranded Biological Sequences" optional = false python-versions = "<4.0,>=3.6" +groups = ["main"] files = [ {file = "seguid-0.1.0-py3-none-any.whl", hash = "sha256:cbc41af5a7aafa7e0bd966c99113cb0395848be9f59685c8713efe114c9c77c9"}, {file = "seguid-0.1.0.tar.gz", hash = "sha256:9dc6f602ec6d42099f1d26d047caf17da36dc5bff1c885418d1dbde559eca542"}, @@ -2855,10 +2995,12 @@ version = "1.17.0" description = "Python 2 and 3 compatibility utilities" optional = false python-versions = "!=3.0.*,!=3.1.*,!=3.2.*,>=2.7" +groups = ["main", "docs", "test"] files = [ {file = "six-1.17.0-py2.py3-none-any.whl", hash = "sha256:4721f391ed90541fddacab5acf947aa0d3dc7d27b2e1e8eda2be8970586c3274"}, {file = "six-1.17.0.tar.gz", hash = "sha256:ff70335d468e7eb6ec65b95b99d3a2836546063f63acc5171de367e834932a81"}, ] +markers = {main = "extra == \"gel\""} [[package]] name = "snowballstemmer" @@ -2866,6 +3008,7 @@ version = "2.2.0" description = "This package provides 29 stemmers for 28 languages generated from Snowball algorithms." optional = false python-versions = "*" +groups = ["docs"] files = [ {file = "snowballstemmer-2.2.0-py2.py3-none-any.whl", hash = "sha256:c8e1716e83cc398ae16824e5572ae04e0d9fc2c6b985fb0f900f5f0c96ecba1a"}, {file = "snowballstemmer-2.2.0.tar.gz", hash = "sha256:09b16deb8547d3412ad7b590689584cd0fe25ec8db3be37788be3810cbf19cb1"}, @@ -2877,6 +3020,7 @@ version = "2.6" description = "A modern CSS selector implementation for Beautiful Soup." optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "soupsieve-2.6-py3-none-any.whl", hash = "sha256:e72c4ff06e4fb6e4b5a9f0f55fe6e81514581fca1515028625d0f299c602ccc9"}, {file = "soupsieve-2.6.tar.gz", hash = "sha256:e2e68417777af359ec65daac1057404a3c8a5455bb8abc36f1a9866ab1a51abb"}, @@ -2888,6 +3032,7 @@ version = "7.4.7" description = "Python documentation generator" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "sphinx-7.4.7-py3-none-any.whl", hash = "sha256:c2419e2135d11f1951cd994d6eb18a1835bd8fdd8429f9ca375dc1f3281bd239"}, {file = "sphinx-7.4.7.tar.gz", hash = "sha256:242f92a7ea7e6c5b406fdc2615413890ba9f699114a9c09192d7dfead2ee9cfe"}, @@ -2924,6 +3069,7 @@ version = "2021.3.14" description = "Rebuild Sphinx documentation on changes, with live-reload in the browser." optional = false python-versions = ">=3.6" +groups = ["docs"] files = [ {file = "sphinx-autobuild-2021.3.14.tar.gz", hash = "sha256:de1ca3b66e271d2b5b5140c35034c89e47f263f2cd5db302c9217065f7443f05"}, {file = "sphinx_autobuild-2021.3.14-py3-none-any.whl", hash = "sha256:8fe8cbfdb75db04475232f05187c776f46f6e9e04cacf1e49ce81bdac649ccac"}, @@ -2943,6 +3089,7 @@ version = "3.0.2" description = "Read the Docs theme for Sphinx" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "sphinx_rtd_theme-3.0.2-py2.py3-none-any.whl", hash = "sha256:422ccc750c3a3a311de4ae327e82affdaf59eb695ba4936538552f3b00f4ee13"}, {file = "sphinx_rtd_theme-3.0.2.tar.gz", hash = "sha256:b7457bc25dda723b20b086a670b9953c859eab60a2a03ee8eb2bb23e176e5f85"}, @@ -2962,6 +3109,7 @@ version = "2.0.0" description = "sphinxcontrib-applehelp is a Sphinx extension which outputs Apple help books" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "sphinxcontrib_applehelp-2.0.0-py3-none-any.whl", hash = "sha256:4cd3f0ec4ac5dd9c17ec65e9ab272c9b867ea77425228e68ecf08d6b28ddbdb5"}, {file = "sphinxcontrib_applehelp-2.0.0.tar.gz", hash = "sha256:2f29ef331735ce958efa4734873f084941970894c6090408b079c61b2e1c06d1"}, @@ -2978,6 +3126,7 @@ version = "2.0.0" description = "sphinxcontrib-devhelp is a sphinx extension which outputs Devhelp documents" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "sphinxcontrib_devhelp-2.0.0-py3-none-any.whl", hash = "sha256:aefb8b83854e4b0998877524d1029fd3e6879210422ee3780459e28a1f03a8a2"}, {file = "sphinxcontrib_devhelp-2.0.0.tar.gz", hash = "sha256:411f5d96d445d1d73bb5d52133377b4248ec79db5c793ce7dbe59e074b4dd1ad"}, @@ -2994,6 +3143,7 @@ version = "2.1.0" description = "sphinxcontrib-htmlhelp is a sphinx extension which renders HTML help files" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "sphinxcontrib_htmlhelp-2.1.0-py3-none-any.whl", hash = "sha256:166759820b47002d22914d64a075ce08f4c46818e17cfc9470a9786b759b19f8"}, {file = "sphinxcontrib_htmlhelp-2.1.0.tar.gz", hash = "sha256:c9e2916ace8aad64cc13a0d233ee22317f2b9025b9cf3295249fa985cc7082e9"}, @@ -3010,6 +3160,7 @@ version = "4.1" description = "Extension to include jQuery on newer Sphinx releases" optional = false python-versions = ">=2.7" +groups = ["docs"] files = [ {file = "sphinxcontrib-jquery-4.1.tar.gz", hash = "sha256:1620739f04e36a2c779f1a131a2dfd49b2fd07351bf1968ced074365933abc7a"}, {file = "sphinxcontrib_jquery-4.1-py2.py3-none-any.whl", hash = "sha256:f936030d7d0147dd026a4f2b5a57343d233f1fc7b363f68b3d4f1cb0993878ae"}, @@ -3024,6 +3175,7 @@ version = "1.0.1" description = "A sphinx extension which renders display math in HTML via JavaScript" optional = false python-versions = ">=3.5" +groups = ["docs"] files = [ {file = "sphinxcontrib-jsmath-1.0.1.tar.gz", hash = "sha256:a9925e4a4587247ed2191a22df5f6970656cb8ca2bd6284309578f2153e0c4b8"}, {file = "sphinxcontrib_jsmath-1.0.1-py2.py3-none-any.whl", hash = "sha256:2ec2eaebfb78f3f2078e73666b1415417a116cc848b72e5172e596c871103178"}, @@ -3038,6 +3190,7 @@ version = "2.0.0" description = "sphinxcontrib-qthelp is a sphinx extension which outputs QtHelp documents" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "sphinxcontrib_qthelp-2.0.0-py3-none-any.whl", hash = "sha256:b18a828cdba941ccd6ee8445dbe72ffa3ef8cbe7505d8cd1fa0d42d3f2d5f3eb"}, {file = "sphinxcontrib_qthelp-2.0.0.tar.gz", hash = "sha256:4fe7d0ac8fc171045be623aba3e2a8f613f8682731f9153bb2e40ece16b9bbab"}, @@ -3054,6 +3207,7 @@ version = "2.0.0" description = "sphinxcontrib-serializinghtml is a sphinx extension which outputs \"serialized\" HTML files (json and pickle)" optional = false python-versions = ">=3.9" +groups = ["docs"] files = [ {file = "sphinxcontrib_serializinghtml-2.0.0-py3-none-any.whl", hash = "sha256:6e2cb0eef194e10c27ec0023bfeb25badbbb5868244cf5bc5bdc04e4464bf331"}, {file = "sphinxcontrib_serializinghtml-2.0.0.tar.gz", hash = "sha256:e9d912827f872c029017a53f0ef2180b327c3f7fd23c87229f7a8e8b70031d4d"}, @@ -3070,6 +3224,7 @@ version = "0.6.3" description = "Extract data from python stack frames and tracebacks for informative displays" optional = false python-versions = "*" +groups = ["test"] files = [ {file = "stack_data-0.6.3-py3-none-any.whl", hash = "sha256:d5558e0c25a4cb0853cddad3d77da9891a08cb85dd9f9f91b9f8cd66e511e695"}, {file = "stack_data-0.6.3.tar.gz", hash = "sha256:836a778de4fec4dcd1dcd89ed8abff8a221f58308462e1c4aa2a3cf30148f0b9"}, @@ -3089,6 +3244,7 @@ version = "0.9.0" description = "Pretty-print tabular data" optional = false python-versions = ">=3.7" +groups = ["docs"] files = [ {file = "tabulate-0.9.0-py3-none-any.whl", hash = "sha256:024ca478df22e9340661486f85298cff5f6dcdba14f3813e8830015b9ed1948f"}, {file = "tabulate-0.9.0.tar.gz", hash = "sha256:0095b12bf5966de529c0feb1fa08671671b3368eec77d7ef7ab114be2c068b3c"}, @@ -3103,6 +3259,7 @@ version = "1.4.0" description = "A tiny CSS parser" optional = false python-versions = ">=3.8" +groups = ["docs"] files = [ {file = "tinycss2-1.4.0-py3-none-any.whl", hash = "sha256:3a49cf47b7675da0b15d0c6e1df8df4ebd96e9394bb905a5775adb0d884c5289"}, {file = "tinycss2-1.4.0.tar.gz", hash = "sha256:10c0972f6fc0fbee87c3edb76549357415e94548c1ae10ebccdea16fb404a9b7"}, @@ -3121,6 +3278,7 @@ version = "2.2.1" description = "A lil' TOML parser" optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "tomli-2.2.1-cp311-cp311-macosx_10_9_x86_64.whl", hash = "sha256:678e4fa69e4575eb77d103de3df8a895e1591b48e740211bd1067378c69e8249"}, {file = "tomli-2.2.1-cp311-cp311-macosx_11_0_arm64.whl", hash = "sha256:023aa114dd824ade0100497eb2318602af309e5a55595f76b626d6d9f3b7b0a6"}, @@ -3155,6 +3313,7 @@ files = [ {file = "tomli-2.2.1-py3-none-any.whl", hash = "sha256:cb55c73c5f4408779d0cf3eef9f762b9c9f147a77de7b258bef0a5628adc85cc"}, {file = "tomli-2.2.1.tar.gz", hash = "sha256:cd45e1dc79c835ce60f7404ec8119f2eb06d38b1deba146f07ced3bbc44505ff"}, ] +markers = {dev = "python_version < \"3.11\"", docs = "python_version < \"3.11\"", test = "python_full_version <= \"3.11.0a6\""} [[package]] name = "tornado" @@ -3162,6 +3321,7 @@ version = "6.4.2" description = "Tornado is a Python web framework and asynchronous networking library, originally developed at FriendFeed." optional = false python-versions = ">=3.8" +groups = ["docs", "test"] files = [ {file = "tornado-6.4.2-cp38-abi3-macosx_10_9_universal2.whl", hash = "sha256:e828cce1123e9e44ae2a50a9de3055497ab1d0aeb440c5ac23064d9e44880da1"}, {file = "tornado-6.4.2-cp38-abi3-macosx_10_9_x86_64.whl", hash = "sha256:072ce12ada169c5b00b7d92a99ba089447ccc993ea2143c9ede887e0937aa803"}, @@ -3182,6 +3342,7 @@ version = "5.14.3" description = "Traitlets Python configuration system" optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] files = [ {file = "traitlets-5.14.3-py3-none-any.whl", hash = "sha256:b74e89e397b1ed28cc831db7aea759ba6640cb3de13090ca145426688ff1ac4f"}, {file = "traitlets-5.14.3.tar.gz", hash = "sha256:9ed0579d3502c94b4b3732ac120375cda96f923114522847de4b3bb98b96b6b7"}, @@ -3197,6 +3358,8 @@ version = "4.12.2" description = "Backported and Experimental Type Hints for Python 3.8+" optional = false python-versions = ">=3.8" +groups = ["dev", "docs", "test"] +markers = "python_version < \"3.13\"" files = [ {file = "typing_extensions-4.12.2-py3-none-any.whl", hash = "sha256:04e5ca0351e0f3f85c6853954072df659d0d13fac324d0072316b67d7794700d"}, {file = "typing_extensions-4.12.2.tar.gz", hash = "sha256:1a7ead55c7e559dd4dee8856e3a88b41225abfe1ce8df57b7c13915fe121ffb8"}, @@ -3208,10 +3371,12 @@ version = "2.3.0" description = "HTTP library with thread-safe connection pooling, file post, and more." optional = false python-versions = ">=3.9" +groups = ["main", "docs", "test"] files = [ {file = "urllib3-2.3.0-py3-none-any.whl", hash = "sha256:1cee9ad369867bfdbbb48b7dd50374c0967a0bb7710050facf0dd6911440e3df"}, {file = "urllib3-2.3.0.tar.gz", hash = "sha256:f8c5449b3cf0861679ce7e0503c7b44b5ec981bec0d1d3795a07f1ba96f0204d"}, ] +markers = {main = "extra == \"download\""} [package.extras] brotli = ["brotli (>=1.0.9)", "brotlicffi (>=0.8.0)"] @@ -3225,6 +3390,7 @@ version = "20.29.1" description = "Virtual Python Environment builder" optional = false python-versions = ">=3.8" +groups = ["dev"] files = [ {file = "virtualenv-20.29.1-py3-none-any.whl", hash = "sha256:4e4cb403c0b0da39e13b46b1b2476e505cb0046b25f242bee80f62bf990b2779"}, {file = "virtualenv-20.29.1.tar.gz", hash = "sha256:b8b8970138d32fb606192cb97f6cd4bb644fa486be9308fb9b63f81091b5dc35"}, @@ -3245,6 +3411,7 @@ version = "0.2.13" description = "Measures the displayed width of unicode strings in a terminal" optional = false python-versions = "*" +groups = ["main", "test"] files = [ {file = "wcwidth-0.2.13-py2.py3-none-any.whl", hash = "sha256:3da69048e4540d84af32131829ff948f1e022c1c6bdb8d6102117aac784f6859"}, {file = "wcwidth-0.2.13.tar.gz", hash = "sha256:72ea0c06399eb286d978fdedb6923a9eb47e1c486ce63e9b4e64fc18303972b5"}, @@ -3256,6 +3423,7 @@ version = "0.5.1" description = "Character encoding aliases for legacy web content" optional = false python-versions = "*" +groups = ["docs"] files = [ {file = "webencodings-0.5.1-py2.py3-none-any.whl", hash = "sha256:a0af1213f3c2226497a97e2b3aa01a7e4bee4f403f95be16fc9acd2947514a78"}, {file = "webencodings-0.5.1.tar.gz", hash = "sha256:b36a1c245f2d304965eb4e0a82848379241dc04b865afcc4aab16748587e1923"}, @@ -3267,6 +3435,7 @@ version = "0.45.1" description = "A built-package format for Python" optional = false python-versions = ">=3.8" +groups = ["main"] files = [ {file = "wheel-0.45.1-py3-none-any.whl", hash = "sha256:708e7481cc80179af0e556bbf0cc00b8444c7321e2700b8d8580231d13017248"}, {file = "wheel-0.45.1.tar.gz", hash = "sha256:661e1abd9198507b1409a20c02106d9670b2576e916d58f520316666abca6729"}, @@ -3281,10 +3450,12 @@ version = "3.21.0" description = "Backport of pathlib-compatible object wrapper for zip files" optional = false python-versions = ">=3.9" +groups = ["main", "docs", "test"] files = [ {file = "zipp-3.21.0-py3-none-any.whl", hash = "sha256:ac1bbe05fd2991f160ebce24ffbac5f6d11d83dc90891255885223d42b3cd931"}, {file = "zipp-3.21.0.tar.gz", hash = "sha256:2c9958f6430a2040341a52eb608ed6dd93ef4392e02ffe219417c1b28b5dd1f4"}, ] +markers = {main = "extra == \"gel\" and python_version < \"3.10\"", docs = "python_version < \"3.10\"", test = "python_version < \"3.10\""} [package.extras] check = ["pytest-checkdocs (>=2.4)", "pytest-ruff (>=0.2.1)"] @@ -3301,6 +3472,6 @@ express = ["cai2"] gel = ["matplotlib", "pillow", "scipy", "scipy"] [metadata] -lock-version = "2.0" +lock-version = "2.1" python-versions = ">=3.9,<4.0" -content-hash = "bab2cffcefa5498abd55f29a4572b09bcdca1beb336728a0af538bd6e0ccb7ef" +content-hash = "c3a6a511bc426ddeb6fe39d378db176bcbf088625f518f26e537545243fcf3de" diff --git a/tests/test_USERcloning.py b/tests/test_USERcloning.py index 43e88c79..ad389a92 100644 --- a/tests/test_USERcloning.py +++ b/tests/test_USERcloning.py @@ -40,12 +40,6 @@ def test_USER_cloning(): assert p.seq.crick == "GAUCGGCCGGATCCAAATGACTGAATTCAAGGCCGtCTTGAAAAAAGCCTGTGAGATCTAAGTCGACATCG" - - - - - - # hej = p.seq # from Bio.SeqFeature import SeqFeature diff --git a/tests/test_module_crispr.py b/tests/test_module_crispr.py index 94d8389c..ee8406ca 100644 --- a/tests/test_module_crispr.py +++ b/tests/test_module_crispr.py @@ -23,14 +23,10 @@ def test_crispr(): """ ) - - sgr_text = "GTTACTTTACCCGACGTCCCgttttagagctagaaatagcaagttaaaataagg" target = "GTTACTTTACCCGACGTCCCaGG" - for sg, tgt in [(sgr_text, target), - (sgr_text.upper(), target.lower()), - (sgr_text.lower(), target.upper())]: + for sg, tgt in [(sgr_text, target), (sgr_text.upper(), target.lower()), (sgr_text.lower(), target.upper())]: containing_sgRNA = Dseqrecord(sgr_text) target = Dseqrecord(target) diff --git a/tests/test_module_myenzymes.py b/tests/test_module_myenzymes.py index dd3c10e4..b4ff1b7c 100644 --- a/tests/test_module_myenzymes.py +++ b/tests/test_module_myenzymes.py @@ -15,13 +15,11 @@ def test_myenzymes(monkeypatch): assert len(list(myenzymes.myenzymes)) == 621 - - - def test_file_is_folder(monkeypatch, caplog): monkeypatch.setenv("pydna_enzymes", "subfolder") from pydna import myenzymes from importlib import reload + reload(myenzymes) assert len(list(myenzymes.myenzymes)) == 0 assert len(caplog.records) == 1 @@ -52,7 +50,8 @@ def test_IOError(monkeypatch, caplog): monkeypatch.setenv("pydna_enzymes", "my_test_enzymes.txt") from unittest.mock import patch - from unittest.mock import mock_open + + # from unittest.mock import mock_open with patch("pydna.myenzymes.open") as mocked_open: mocked_open.side_effect = IOError() @@ -75,7 +74,8 @@ def test_Exception(monkeypatch, caplog): monkeypatch.setenv("pydna_enzymes", "my_test_enzymes.txt") from unittest.mock import patch - from unittest.mock import mock_open + + # from unittest.mock import mock_open with patch("pydna.myenzymes.open") as mocked_open: mocked_open.side_effect = Exception() diff --git a/tests/test_module_parsers.py b/tests/test_module_parsers.py index d7c23156..b59087fb 100644 --- a/tests/test_module_parsers.py +++ b/tests/test_module_parsers.py @@ -20,9 +20,10 @@ def test_extract_from_text(): // """ from pydna.parsers import extract_from_text + seqs, gaps = extract_from_text(text) - assert seqs == ('>a\naaaa\n', 'LOCUS\n//', '>b\nbbbbbb\n', 'ID\n//') - assert [g.strip() for g in gaps] == ['', '', '', '', ''] + assert seqs == (">a\naaaa\n", "LOCUS\n//", ">b\nbbbbbb\n", "ID\n//") + assert [g.strip() for g in gaps] == ["", "", "", "", ""] text = """\ comment 0 LOCUS a @@ -42,14 +43,12 @@ def test_extract_from_text(): comment 4 """ seqs, gaps = extract_from_text(text) - assert seqs == ('LOCUS a\n//', 'LOCUS b\n//', '>c\nccccc', '>ddd\ndddddd\n', 'ID e\n//') - assert tuple(g.strip() for g in gaps) == ('comment 0', 'comment 1', 'comment 2', 'comment 3', '', 'comment 4') - - + assert seqs == ("LOCUS a\n//", "LOCUS b\n//", ">c\nccccc", ">ddd\ndddddd\n", "ID e\n//") + assert tuple(g.strip() for g in gaps) == ("comment 0", "comment 1", "comment 2", "comment 3", "", "comment 4") from pydna.parsers import embl_gb_fasta - text = """\ + text = """\ LOCUS New_linear_DNA 2 bp DNA linear 29-MAR-2024 DEFINITION . ACCESSION @@ -76,7 +75,7 @@ def test_extract_from_text(): assert crc.annotations.get("topology") == "circular" - text = """\ + text = """\ >a aaa >c @@ -87,11 +86,11 @@ def test_extract_from_text(): ttt """ - a,c,t,g = embl_gb_fasta(text) + a, c, t, g = embl_gb_fasta(text) - assert [x.annotations.get("topology") for x in (a,c,g,t)] == ['linear', 'linear', 'linear', 'linear'] + assert [x.annotations.get("topology") for x in (a, c, g, t)] == ["linear", "linear", "linear", "linear"] - text = """\ + text = """\ >a circular aaa >c circular @@ -102,10 +101,9 @@ def test_extract_from_text(): ttt """ - a,c,t,g = embl_gb_fasta(text) - - assert [x.annotations.get("topology") for x in (a,c,g,t)] == ['circular', 'circular', 'circular', 'circular'] + a, c, t, g = embl_gb_fasta(text) + assert [x.annotations.get("topology") for x in (a, c, g, t)] == ["circular", "circular", "circular", "circular"] def test_parse1(): @@ -173,20 +171,20 @@ def test_parse1(): correct = """ATGACTGAATTCAAGGCCGGTTCTGCTAAGAAAGGTGCTACACTTTTCAAGACTAGATGTCTACAATGCCACACCGTGGAAAAGGGTGGCCCACATAAGGTTGGTCCAAACTTGCATGGTATCTTTGGCAGACACTCTGGTCAAGCTGAAGGGTATTCGTACACAGATGCCAATATCAAGAAAAACGTGTTGTGGGACGAAAATAACATGTCAGAGTACTTGACTAACCCAAAGAAATATATTCCTGGTACCAAGATGGCCTTTGGTGGGTTGAAGAAGGAAAAAGACAGAAACGACTTAATTACCTACTTGAAAAAAGCCTGTGAGTAA""" assert str(result.seq) == correct - assert result.circular == False + assert result.circular is False seqs = parse("RefDataBjorn.fas") assert len(seqs) == 771 assert list(set([len(a) for a in seqs])) == [901] pAG25 = read("pAG25.gb") - assert pAG25.circular == True + assert pAG25.circular is True pCAPs = read("pCAPs.gb") - assert pCAPs.circular == True + assert pCAPs.circular is True pUC19 = read("pUC19.gb") - assert pUC19.circular == True + assert pUC19.circular is True input = """ ID example standard; DNA; UNC; 3 BP. @@ -221,12 +219,13 @@ def test_parse1(): // """ result = parse(input).pop() - assert str(result.seq) == "A"*100 + assert str(result.seq) == "A" * 100 def test_parse2(): from pydna.parsers import parse - from pydna.readers import read + + # from pydna.readers import read seqs = parse("RefDataBjorn.fas") @@ -236,7 +235,7 @@ def test_parse2(): for i, s in enumerate(seqs): a = s.description b = a.split() - c = "|".join([b[0], b[1], b[3]]) + # c = "|".join([b[0], b[1], b[3]]) s.id = b[2].replace(" ", "_") + "_" + str(i) s.description = "" if b[3] == "Zenion hololepis": @@ -245,17 +244,21 @@ def test_parse2(): def test_parse_primers(): from pydna.parsers import parse_primers + data = str(">1\n" "aaaa\n" ">2\n" "cccc\n") parse_primers(data) - f0, r0 = parse_primers(""" + f0, r0 = parse_primers( + """ >ForwardPrimer gctactacacacgtactgactg >ReversePrimer - tgtggttactgactctatcttg""") - assert str(f0.seq) == 'gctactacacacgtactgactg' - assert str(r0.seq) == 'tgtggttactgactctatcttg' + tgtggttactgactctatcttg""" + ) + assert str(f0.seq) == "gctactacacacgtactgactg" + assert str(r0.seq) == "tgtggttactgactctatcttg" + def test_parse_error(): from pydna.parsers import parse @@ -272,19 +275,20 @@ def test_parse_list(): data = str(">1\n" "aaaa\n" ">2\n" "cccc\n") - assert [str(x.seq) for x in parse_primers([data, data])] == ['aaaa', 'cccc', 'aaaa', 'cccc'] + assert [str(x.seq) for x in parse_primers([data, data])] == ["aaaa", "cccc", "aaaa", "cccc"] def test_misc_parse(): from pydna.parsers import parse - from Bio.SeqIO import read as BPread + + # from Bio.SeqIO import read as BPread from Bio.SeqIO import parse as BPparse - q = BPread("read1.gb", "gb") - w = BPread("read2.gb", "gb") - e = BPread("read3.fasta", "fasta") - r = BPread("read4.fasta", "fasta") + # q = BPread("read1.gb", "gb") + # w = BPread("read2.gb", "gb") + # e = BPread("read3.fasta", "fasta") + # r = BPread("read4.fasta", "fasta") with open("pth1.txt", "r", encoding="utf-8") as f: a, b = BPparse(f, "gb") @@ -314,8 +318,10 @@ def test_dna2949(): assert len(seqlist) == 1 assert seqlist[0].seguid() == "ldseguid=ScLoSddUf2c0GIAGpvIi33nLvFY" + def proteins(): from pydna.parsers import embl_gb_fasta + proteins = """\ >pdb|3VQM|V Chain V, C-terminal peptide from Small heat shock protein StHsp14.0 VIKIE @@ -355,7 +361,6 @@ def proteins(): // """ - fa, gb = embl_gb_fasta(proteins) assert fa.annotations["molecule_type"] == "protein"