Support biopython 1.85 and drop python 3.8

.flake8

@@ -1,5 +1,5 @@
 [flake8]
-ignore = E203, E266, E501, W503, F403
-max-line-length = 79
+ignore = E203, E266, E501, W503, F403, E741, B905
+max-line-length = 119
 max-complexity = 18
 select = B,C,E,F,W,T4,B9

.github/workflows/pydna_test_and_coverage_workflow.yml

@@ -15,13 +15,11 @@ jobs:
       fail-fast: false
       matrix:
         os: ["macos-latest", "windows-latest"]
-        python-version: ["3.12", "3.11", "3.10", "3.9", "3.8"]
+        python-version: ["3.12", "3.11", "3.10", "3.9"]
         include:
-          - os: ubuntu-latest
-            python-version: "3.8"
-            codecov: true
           - os: ubuntu-latest
             python-version: "3.9"
+            codecov: true
           - os: ubuntu-latest
             python-version: "3.10"
           - os: ubuntu-latest
@@ -51,7 +49,6 @@ jobs:
         uses: snok/install-poetry@v1
         with:
           virtualenvs.prefer-active-python: true
-          version: ${{ matrix.python-version == '3.8' && '1.8.2' || 'latest' }}
       - name: 🔩 list Poetry settings
         run: poetry config --list
 

.pre-commit-config.yaml

@@ -7,6 +7,8 @@ repos:
     args: [--branch, master]
   # Format yaml files
   - id: check-yaml
+  # Ignore conda build meta.yaml files
+    exclude: ^scripts/conda-build/meta.*\.yaml$
   # Fix end-of-file issues
   - id: end-of-file-fixer
   # Fix trailing whitespace

pyproject.toml

@@ -1,7 +1,7 @@
 [project]
 authors = [
-    {name = "Björn F. Johansson", email = "[email protected]"},
-    {name = "Manuel Lera-Ramirez", email = "[email protected]"}
+  { name = "Björn F. Johansson", email = "[email protected]" },
+  { name = "Manuel Lera-Ramirez", email = "[email protected]" },
 ]
 classifiers = [
   "Development Status :: 4 - Beta",
@@ -11,7 +11,6 @@ classifiers = [
   "Intended Audience :: Science/Research",
   "License :: OSI Approved :: BSD License",
   "Operating System :: OS Independent",
-  "Programming Language :: Python :: 3.8",
   "Programming Language :: Python :: 3.9",
   "Programming Language :: Python :: 3.10",
   "Programming Language :: Python :: 3.11",
@@ -27,7 +26,10 @@ readme = "README.md"
 Changelog = "https://github.com/pydna-group/pydna/blob/master/docs/CHANGELOG.md#changelog"
 [tool.poetry]
 description = "Representing double stranded DNA and functions for simulating cloning and homologous recombination between DNA molecules."
-authors = ["Björn F. Johansson <[email protected]>", "Manuel Lera-Ramirez <[email protected]>"]
+authors = [
+  "Björn F. Johansson <[email protected]>",
+  "Manuel Lera-Ramirez <[email protected]>",
+]
 documentation = "https://pydna-group.github.io/pydna"
 homepage = "https://github.com/pydna-group/pydna#-pydna"
 license = "BSD"
@@ -37,21 +39,18 @@ repository = "https://github.com/pydna-group/pydna/tree/master"
 version = "6.0.0-a.24.post.17+b7b559bd66"
 [tool.poetry.dependencies]
 appdirs = ">=1.4.4"
-biopython = ">=1.80,<1.85"
+biopython = "1.85"
 cai2 = { version = ">=1.0.5", optional = true }
 matplotlib = { version = ">=3.4.3", optional = true }
 networkx = ">=2.8.8"
-numpy = [
-  { version = ">1.26", python = ">=3.9" },
-  { version = "<1.24", python = "<3.9" },
-]
+numpy = ">1.26"
 pillow = { version = ">=8.4.0", optional = true }
 prettytable = ">=3.5.0"
 pydivsufsort = ">=0.0.14"
 pyfiglet = "0.8.post1"
 pyparsing = { version = ">=2.4.7", optional = true }
 pyperclip = { version = ">=1.8.2", optional = true }
-python = ">=3.8,<4.0"
+python = ">=3.9,<4.0"
 requests = { version = ">=2.26.0", optional = true }
 scipy = [
   { version = ">=1.11.3", python = ">=3.12", optional = true },
@@ -88,19 +87,16 @@ sphinx-autobuild = "^2021.3.14"
 sphinx-rtd-theme = ">=1.3,<4.0"
 nbconvert = "^7.16.4"
 myst-parser = [
-  { version = ">3.0.0", python = "<3.10"},
-  { version = ">=4.0.0", python = ">=3.10"},
+  { version = ">3.0.0", python = "<3.10" },
+  { version = ">=4.0.0", python = ">=3.10" },
 ]
 
 [tool.poetry.group.dev.dependencies]
 autopep8 = "^2.1.0"
 black = "^24.4.2"
-flake8-bugbear = [{ version = ">=24.4.21", python = ">=3.8.1" }]
-pre-commit = [
-  { version = ">3.6", python = ">=3.9" },
-  { version = "<3.6", python = "<3.9" },
-]
+pre-commit = ">3.6"
 nbstripout = "^0.7.1"
+flake8-bugbear = "^24.12.12"
 
 [tool.pytest.ini_options]
 minversion = "6.0.2"

scripts/conda-build/meta (copy).yaml

@@ -10,7 +10,7 @@ source:
   path: .
 requirements:
     host:
-    - python>=3.8,<4.0
+    - python>=3.9,<4.0
     - pip
     - poetry-core
     - poetry-dynamic-versioning

scripts/conda-build/meta (copy2).yaml

@@ -11,7 +11,7 @@ source:
   path: .
 requirements:
     host:
-    - python >=3.8
+    - python >=3.9
     - pip
     - poetry
     - poetry-dynamic-versioning

scripts/conda-build/meta2.yaml

@@ -10,7 +10,7 @@ source:
   path: .
 requirements:
     host:
-    - python>=3.8,<4.0
+    - python>=3.9,<4.0
     - pip
     - poetry-core
     - poetry-dynamic-versioning

scripts/conda-build/myenvironment.yaml

@@ -9,7 +9,7 @@
 ###############################################################################
 name: some-name-env
 dependencies:
-  - python>=3.8,<4.0
+  - python>=3.9,<4.0
   - conda-forge::appdirs>=1.4.4,<2.0.0
   - conda-forge::biopython>=1.80,<2.0
   - conda-forge::networkx>=2.8.8,<3.0.0

src/pydna/dseq.py

@@ -1479,11 +1479,6 @@ def cutsite_is_valid(self, cutsite: CutSiteType) -> bool:
         enz = cutsite[1]
         watson, crick, ovhg = self.get_cut_parameters(cutsite, True)
 
-        # The cut positions fall within the sequence
-        # This could go into Biopython
-        if not self.circular and crick < 0 or crick > len(self):
-            return False
-
         # The overhang is double stranded
         overhang_dseq = self[watson:crick] if ovhg < 0 else self[crick:watson]
         if overhang_dseq.ovhg != 0 or overhang_dseq.watson_ovhg() != 0:

src/pydna/dseqrecord.py

@@ -788,9 +788,10 @@ def __mul__(self, number):
         if self.circular:
             raise TypeError("TypeError: can't multiply circular Dseqrecord.")
         if number > 0:
-            new = _copy.copy(self)
+            new = _copy.deepcopy(self)
             for i in range(1, number):
                 new += self
+            new._per_letter_annotations = self._per_letter_annotations
             return new
         else:
             return self.__class__("")
@@ -1061,7 +1062,10 @@ def upper(self):
         pydna.dseqrecord.Dseqrecord.lower"""
 
         upper = _copy.deepcopy(self)
+        # This is because the @seq.setter methods otherwise sets the _per_letter_annotations to an empty dict
+        prev_per_letter_annotation = upper._per_letter_annotations
         upper.seq = upper.seq.upper()
+        upper._per_letter_annotations = prev_per_letter_annotation
         return upper
 
     def lower(self):
@@ -1092,7 +1096,9 @@ def lower(self):
 
         """
         lower = _copy.deepcopy(self)
+        prev_per_letter_annotation = lower._per_letter_annotations
         lower.seq = lower.seq.lower()
+        lower._per_letter_annotations = prev_per_letter_annotation
         return lower
 
     def orfs(self, minsize=300):

src/pydna/seqrecord.py

@@ -50,10 +50,29 @@ class SeqRecord(_SeqRecord):
     nicer output in the IPython shell.
     """
 
-    def __init__(self, seq, *args, id="id", name="name", description="description", **kwargs):
+    def __init__(
+        self,
+        seq,
+        id="id",
+        name="name",
+        description="description",
+        dbxrefs=None,
+        features=None,
+        annotations=None,
+        letter_annotations=None,
+    ):
         if isinstance(seq, str):
             seq = _Seq(seq)
-        super().__init__(seq, *args, id=id, name=name, description=description, **kwargs)
+        super().__init__(
+            seq,
+            id=id,
+            name=name,
+            description=description,
+            dbxrefs=dbxrefs,
+            features=features,
+            annotations=annotations,
+            letter_annotations=letter_annotations,
+        )
         self._fix_attributes()
 
     def _fix_attributes(self):
@@ -612,7 +631,7 @@ def removeprefix(text, prefix):
 
         if format == "pydnafasta":
             return _pretty_str(
-                f">{self.id} {len(self)} bp {dict(((True,'circular'),(False,'linear')))[self.seq.circular]}\n{str(self.seq)}\n"
+                f">{self.id} {len(self)} bp {dict(((True, 'circular'), (False, 'linear')))[self.seq.circular]}\n{str(self.seq)}\n"
             )
         if format == "primer":
             return _pretty_str(

tests/test_module_dseq.py

@@ -116,16 +116,16 @@ def test_initialization():
 
     obj2 = Dseq("gata")
 
-    assert obj2.circular == False
+    assert not obj2.circular
 
-    l = Dseq("gt")
-    c = l.looped()
+    lin_seq = Dseq("gt")
+    cir_seq = lin_seq.looped()
 
-    assert not l.circular
-    assert c.circular
+    assert not lin_seq.circular
+    assert cir_seq.circular
 
-    assert Dseq("gt", circular=False) == l
-    assert Dseq("gt", circular=True) == c
+    assert Dseq("gt", circular=False) == lin_seq
+    assert Dseq("gt", circular=True) == cir_seq
 
     assert Dseq.from_string("A") == Dseq("A")
     assert Dseq.from_string("A", circular=True) == Dseq("A", circular=True)
@@ -218,7 +218,7 @@ def test_Dseq_cutting_adding():
         ovhg=0,
     )
 
-    f, d, l = c.cut((EcoRI, PstI))
+    f, d, _ = c.cut((EcoRI, PstI))
 
     assert d.watson == "GtcatctactatcatcgtagcgtactgatctattctgctgctcatcatcggtactctctataattatatatatatgcgcgtG"
     assert d.crick == "AATTCacgcgcatatatatataattatagagagtaccgatgatgagcagcagaatagatcagtacgctacgatgatagtagatgaCTGCA"
@@ -554,11 +554,6 @@ def test_dseq():
 
 def test_Dseq_slicing():
     from pydna.dseq import Dseq
-    from pydna.readers import read
-    from pydna.utils import eq
-
-    from Bio.Seq import Seq
-    from Bio.SeqRecord import SeqRecord as Srec
     from Bio.Restriction import BamHI
 
     a = Dseq("ggatcc", "ggatcc", 0)
@@ -947,7 +942,7 @@ def test_apply_cut():
 def test_cutsite_is_valid():
 
     from pydna.dseq import Dseq
-    from Bio.Restriction import EcoRI, BsaI, PacI, NmeDI, Acc65I, NotI, BamHI, EcoRV
+    from Bio.Restriction import EcoRI, PacI, NmeDI, EcoRV
 
     # Works for circular case
     seqs = ["GAATTC", "TTAATTAAC", "GATATC"]
@@ -977,7 +972,7 @@ def test_cutsite_is_valid():
                 assert len(dseq.get_cutsites([enz])) == 1
 
     # Special cases:
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 0, 0)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 0, 0)
     assert len(dseq.get_cutsites([NmeDI])) == 2
     # Remove left cutting place
     assert len(dseq[2:].get_cutsites([NmeDI])) == 1
@@ -987,27 +982,27 @@ def test_cutsite_is_valid():
     assert len(dseq[2:-2].get_cutsites([NmeDI])) == 0
 
     # overhang left side
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", -2, 0)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", -2, 0)
     assert len(dseq.get_cutsites([NmeDI])) == 1
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 2, 0)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 2, 0)
     assert len(dseq.get_cutsites([NmeDI])) == 1
 
     # overhang right side
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 0, 2)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 0, 2)
     assert len(dseq.get_cutsites([NmeDI])) == 1
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 0, -2)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 0, -2)
     assert len(dseq.get_cutsites([NmeDI])) == 1
 
     # overhang both sides
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 2, 2)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 2, 2)
     assert len(dseq.get_cutsites([NmeDI])) == 0
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", -2, -2)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", -2, -2)
     assert len(dseq.get_cutsites([NmeDI])) == 0
 
     # overhang on recognition site removes both cutting places
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 16, 0)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 16, 0)
     assert len(dseq.get_cutsites([NmeDI])) == 0
-    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAAAAAAAAAGCCGGCAAAAAAAAAAAA", 0, 16)
+    dseq = Dseq.from_full_sequence_and_overhangs("AAAAAATTTTTTTGCCGGCAAAAAAAATTTTT", 0, 16)
     assert len(dseq.get_cutsites([NmeDI])) == 0